Description :
From Genome Similarity Track
Location :
Scaffold_223:6020- 8116
Transcript NameFunction/comments
g11673.t1hypothetical protein

Sequence
2096 bases(100 bases per row)
CCCATGTTACATAAAGAGTGACGGGATGTCTCTCTTTTGTGCCCATGGTACGTGGTACCGGTTGGCGGTGAGCCAACCATTGGGCACTTGTTTAGCTTTT
ACTATAGTTTGTAAGGATCAAGCTTGACTCACCTATACAATATATTCAGTCTTTAAACCTACCGTCTAAGTCGTAGTCGGTTCCCTTAGACCGGGGACCG
TGAACTTGTTGTTCACCGAGAGCTTACGCTCTCTAGCACTTCCTCTGTGCAAGGTGCTGTGTGCCCCGTCACACTTGGTAGCACTTGTAGTCAATCCACG
CCTACGCGGGTAGGATTGGACTACCTGAATCCTCTGTGGTCTCAAAGCCTGAGCCACTATGGAACGAAGTGAGTTTCCTCACTTGAACGACTCGCAGTTC
GAGTCCGTTCGAAAGATGGGAGGCATCTTTGGGAGGGATGTCCTCCGAGGCTTGGCGTCGGTGATGCCAGCCGAGCCAGTCGAACGCGTGAGCTCATTGC
TCACGCGCAGGGAAACCTGCAGGCCTCTGTGGCCGAGCCGAAGCCGGTCCAGCCGAAGCCTTTGCGGCTGGCTGTGCCTGCGTTCGAAGGGAAGGAAGGT
GAAAACCTTCACTTCTGGATCCGAGAAGTTGAGATCGCCATGAGGGCGGGTCTCATCTCGGATCAGGGACTTCGCGTTGCGTTCGCGTTGTCCAACCTAA
GGGGTCGTGCCAAGAATTGGGCGTACACGCTGGAGACGACGTCTCCTGGATGCTTTGCATCCTGGGAACAGTTGTGCGAGCGGCTTCGCGCTGCGTTTCT
CCCGGCGAACGATGCGTTCCGGCAGCGCTCACGCTTCCTCGCCTGTAAGCAAGGGAAGCGCGAGCTGTACGAGTACGTACAAGAGATGCACACGTTGGCA
TCATCGTTGGTGGGGAACCCCCTGCCCGAAGTCGTCAAGACGACGGACTTCATGGACGGCCTGAAGGTCGGTCCCGCACGCAGTTATTCCGCGTGCATGC
ATCCACTATGGAGGAGGCGATTAAGATCGCCCTCCAGGAGGAGTACAGCCATAAGCAGTCTGGTACTCCGGTTGTTGCGCAACTTGTCGTTGCGAACAAC
GAGCCAAAGCCTATGGACTTGAGCTCTGCTGAGCTTGGCTCGGTCCGCTGCTATAAATGCGGCGGACTAGGACACTACCAACGCGTGTATCCTTTGACTG
GGGTGGGGAAGAACGCATCCCTCAAACCCCGAGGGCCTAACGGTCGCTGGCGCAAGCCGCGGCCAGGTGGCCGAGGGAACTCCGGCCACCAGTAATGGCG
GGTTCCCCAGAGGGGGGAGAATTGAGTCTCTGTGACGGGTGTGCGGGTGGCGCACATCATGGAGGCTTAGCCTACGAGAGACATTATGTCTCGAATCGGT
GATGGCAACGCTGGGTTGCCGTTAGTACACGTGAGTGTACGGGGATGTTAATATCCCTAGGAACGTTTAATTCCAGGGGCGTCGAATGCTTTCGTACGCC
GCCGGAGCGATTGTCAACTCTCTGTGAGAGAGCATCGACAATGGTCTGCATAGACCTTGCTGTCAGGTTCACATACCTGAACAGCTGCGACCCGTACGTG
GTCGTGGACACGTACGGCGTCCGCTTGGGTGCGCCGTGCCATGTACGCACGCACCCTGAAGCAATTGGTGTCGGAAAGCCATCTAGGCTAACCGGCACCC
AGCTTCTGGCAGAGCATTGGTGAGTCATGACCCCACCTCTGCCAGAACACGCGGTATCCGAAAGGATTACCAGGACGCAATGGTGTCCGCCGACGTACGG
AAGTCGTCGGAGTAGTTGCAGCTGCAACAGGTGTTGAGACACCGTCCACTGCGGGCAATGGACCGCCACAGGCAATGCCGGTGGACAGGACTAATAGTCC
AGCGAGGGGAGCTGCAACGTCAGCACCCACCGCTCCTGATCGTGGCGCCATACAGGCCTCGACTGTATCAGCGCCAGGGGATGTCAGCTCCCCAGTAGAA
CAAGTCCACGTGAGGCCAAGACGGCCGAGACCGTGGTCAGGGCTGAGGTTGCCGAGAGCACCTCCTGTGTGGGTAACAATGTGCCACACGGAGTCG