Description :
From Genome Similarity Track
Location :
Scaffold_3856:602- 2056
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_3856-fgenesh-gene-0.0Amino Acid/Auxin Permease (AAAP) Family

Sequence
1454 bases(100 bases per row)
GTCCGGGTTGAAGAGGTTCTTGCCCGAGTGGTACGTGACGTAGCACCCGAGGCAGAAGCAGATGAGCACCACGAGGATGGCCGGCACCTTCTCGTAGATC
GGGATCTTGGTCCAGAGCTTCATGAGGTAGAAGATGATGGGCAGGATGATGCAGCACATGGTGATGCAAGACGCGCCGACAAAGTCCGACAGGTCCAGGA
AGTGGTCCTTGAGCAGCACGGACGCCACCACCTGCAAAACCACGATGGTGCAGCGTAGGATGACGTACTTGAACGCGTTCGCGCCCTTGTACTCGGCGGC
CTCGACCTCCTCGTTCACGCTCTCGCGCTCAATGTCGGCCATGGACACGACCGAGCCCTTGGACGTGCGGTTCTTGAATTCCGCCGCCGGCGTCTCCACG
GCCTCGTAGTTGAGCGCCTCGATGTCGTCCGGCTTCTTCTGGTGCATGCCCAGCACGAGGCGCTCCGAGATGTAAAACGCCGGTGAGACGATGACGGCGA
AGGCGACGGTGATGTGCAGCTGCATGAAGAGGTACGCGAGCACGACCATGCCCTTGTCGGACGCGAAGCCGAGCTTGGTGAGGCCCGTGGTCTCGTCCGG
GAGGATCGTGAAGAGCAGGTTGCCCGAGATCTGGCAGCCGACGGTCGAGTAGCCCGAGCCGGCCAGCGCCAGGAAGAGCACCGAGATGAAGCTGAGCGTG
ACGCCCACGATGCGCGGCATACGCGTCGGCTCGCTGTGCTGGCGCTGTAGCGCGGGGATGACGATCGTGGCGCCGTAGGCGAGCGAGAGGTTGCCGAAAG
TCGTGGCCACCTGCTTGAACGAGAGCTCTGGCGTCGGGATGGACGGGTGGCCGTTCATGCCGTGGACGAGCACTGCGACGCCGATGACGTCGGCGATGAG
CGTTCCCATGCAGCCGGCGAAGGCCGCACCGGCGCCCTCCTTGAGCGTGGGCGTGAGGCACACAGGCAGCACCATGAGCGCCATGAGAATGATCCACGTC
GCCTGGCCGAACGTACCTGGGAAGAGACTCGAGAGCAGTGTGCCACCGAGCACGAGGAAGGCGCACGGGACGAGCAGGCAGACACCCATCTGGGAGATGA
CGACGAGGTAGCGGCCGGGCTTGCCCATGCACCACTCGCCCAGGTCGCCAAAAGTCTTGACGCTCTTGGGGGCCAGCAGCATGACCTTGGAGCACACGAC
GCCCGAGTAGACGTTGGCGAAGGCCATGAAGAGCAGCGCGAGCGTGGCGATGACGGGCCCGGCGCGGGAGAAGTTGGCGGGCATGCCGAGCGTGCCGATG
CCGTAGACGCAGCAGAAGAGGCTGAAGGCGATCTTGGCGTCTTCGAGCGTGAACCAGGCCTTGGAGCCCATGGCGATGGCTGGGGACTGGGGAGAGGGCG
GGTGCGCAGGACGAGGCGAATTCGCAACTGAGCTCTTCGCAGCGAGCAGCTCAG