Description :
From Genome Similarity Track
Location :
Scaffold_59:60190- 65285
Transcript NameFunction/comments
Phyke_g2742hypothetical protein PHYSODRAFT_474030
Phyke_g2743hypothetical protein PHYSODRAFT_537889

Sequence
5095 bases(100 bases per row)
GACATGGAGAAACATGAACCGTGGCTCTTCCAGAGCACCAACTTGAAGCCATTCCCATCCAGGCTCGGAGCTCCACCCAGTCTCACAATCTCGACAGGCG
ATAGCTCGTTATTTTACTTGGACCTCAACAGCTTGAAGAGTTTGCTGCCTTCAGCTGATTCTAGACattggccaagaagcggtgacgatggcaacagcTA
CCCATCGAACTTTTCAAATATTCGTGCGCCAGGGAGTCGAGGACGCCAAGTCCCACCTGCAAGACTAGAGGCGTTGAATCTCAAAACTGACAAGAAGCAC
CGAAAACGAAAACGAAGGCGACAAGTACAAATTCTTAGGAGAAAGGCTCTGCGACTCGATTCAGCCAAAGTGAGACCATCCACACAAGAATTACAAgacg
ttgatgctgctgcagtatACTCACATCCGTCTCCAACCAAGACTGGCAGAAGtaagaagacaaagaagaagtCGGACCGAAAGAGTGGTGCCGGTCGCCA
TTCACCTTTGAGACGCTCTCCAGCGCACTATGCGATCGATTACGATTCAGATGGTCAACGTGTAGATCGCTCCGACAAACCGGCAGCTCTGCTTGAAGAc
cttgatgaagagcagcgacagaaagctgcaattgcaaccCACCTGAACTTGACATTGGAGGAATACGAACGTTTGGATGCTGCTTTTGGTACCAATTCAC
AGCACAAGCATGAAAATGACGCTGGGCCCACGACAGAAAGGTACTATGAGCAATTTCAAGAGTTTGACGTTGATAATAGCGGCTCCATCTCGCCCGAGGA
ATTACgacaaatgctgctggcctCTGGAGAAGATATGGACGACGCCGAGTTAGCATCCGTCATACAGCAAGCTGACACAGATCATGACGGTGAAATCAAC
TTTGAGGAGTTCATCGCACTGATGCGCGCTCGCAAGAGACTCCTTCAGGTCGCCAACCAGATGGGGGTCAATGGCAATGGCCTGACAAATAGCAACAGTA
CATTCAGTCCTGGGTTTAACCTACATTCCAATTCTACGGGGCAGTCCTTGCCGCCGCTGAAGCTTGCAGCACGTCAAGCTAAACGCCACCTGCAGCCTTA
TCACAAAATATCTGTCGGCTCTCGCCAGACGCCATCATGTCTTCGTCCAGGAGCGAAAGTGGATGTTGTGGAGCTGCGACGAGAGCTAGCACTCTCCGAG
TATGGTATTCAAGAGCTCAACTCGAAGGTGCGAGAAGGACTGCAGTGGGTCCAACAGCACTGTCCTGTGACGTCGCTCAAAGCGCAAATTTTCTGCCATC
GATGGGGAATGGAAAAAGTGCACCAGCTCTTCTTACGACTCCAGTCGCAACAACTCTCTCGTGCATTCCAGAAGTGGTCAGCCTTCCGCATGTTTGAGCG
CAACAAGATTAAAGCCAACATGTTCCTCAAATGCAAGGCCAGCCAGAAGATGGCCTCAATcatgaccaagtggaagcGCAACGTCACACGCCGCAAATTT
TCACACTGGAAAACGGAGTGCATCCTGGATGCTCGAAACGAAATGCACTCTGCTGCTATCGAGATTCAGCGCGTCGTGCGTGGCGACCTTGCTCGTCTGC
TTCGGCAGCGTATGAAAGAGGACATCGCTGTCCTTCATATCCAGACGCTTGTTCGTGGCTGTTTGGCGAGAGTATTAGCAAGTCAAAAACGCCAAGCCAA
GTTGGAGCATCAAGCTGCaagcttgctgcagcactgctaCCGAGGCTACACCGGAAAACGTTTGGCCCGAGCGCTTTTCAAAGCCCAGCGTGAAACACTC
GCAGCTTGCCATATTCAGCGTGCGTTCCGTAATTTCCAACGACGAGTACTTCTCGCCGTGATTCAGCGCACCAAGCTTGAAAATGACTCTGCCCTCACCC
TGCAATGCAGCATGCGCAGCTATCTTGCGAGACGTGAACGAAATCGCCGTTTGACTTGTCGGCTGCGAGAACGTAGCGCAGCGATTGTTCAGCGCTATAC
ACGTGGTTTTCTTGCTCGACGCCATGTGTTCAACATCAAGAAACAGATCCGTGCAGCTTTGACCATCCAATGTTTCCTCCGAGCGAGCCAAGCGCATTGT
CGGGTGCATATTCTGCGGACGGAAAAGCTCCACAAGGAACGCCTAGCTATTGAACACGTCGCCGCGACAAAAATCCAAGCGCTGTGGCgttgcaccagca
cacgAAATCGGTACTTGACCGACAAGAAACGGCGAGAGGAGGCTTTGAAGCTGGAACGATTCCGAAGATTCACGAGTGCCGTGCAAATTCAGTCAATTTT
CCGTGGGTACCTGGCACGCCGCTGCGCACAGCGTGTTCGATTCGAGAAGCTGAAATGGATGAATTTCGCACTCATGAATAGCAGTGCATTGAAAATTCAA
GCGTACTGGCGTGGGTATCATGGTCGCTTTGCCTCGCATTTGCGACTTCAGGCacagaaacaacaacaacaccaagagAACGAAGCTGCAAAGCGCATTC
AGGTCATTGCGAGAGGGAAGCTTGCTCGGGAGGAACGTCGAAAACTCGATCAGCAACGTGCGAAGTTAGCGTCGCAGCAGCGCACTCGCGCAAAGGCTGC
TTTGCGCATCCAGAAGATATTCCGAGGCAAACAGGCTCGAAAATTGGCACGTGAGCTACAGCAGAAGCATCACGAGGAAGCCCGTCTTGCACTTGAACGC
CTAGTTCAATTGACCAAGACGCGGTCTGCAGTGAAAATTCAGAGCTGTGCTCGACGGTTCCTTGCAAAATGTCACTACCTGCAGCGTGTACGTGAAATGG
AGCGCCGCAGACAAGAGGAAGGACTTCGATTCACACAAAATCGCGCTGCAATCGTTATTCAATGTGCTATGCGGCGTGCTGGCGCTCGACGTCTTTTGTT
GCAACGGCGACGTGAGTTCGAGAAGCGAATTTCTATGATGGCTTCCGAGAAAGCTcacgacgagatcgagagGCTACGCaaggagcaggaagaagagctt
ctgAAGCTCAAAATGCAGTTGATGTTCCAACAGAACACCGCCAACGAAGAGGCTGCGAAACTACGCGATGAGATCGctcggcagcaagaagaagaggaac
aaCGTCATAGGGAGGAAGCGCAGGAATTAGCACGTCTACGGATCGAGACACtcatgcagcagcgtgatATTGATACTCGCGTGGAGCAAGATCAGTTGAA
GAAATTCGAGGCGCAGCGACTACGTGAGAGactggaaatggagaagcaggctcagcaagagaaggaggctgcaATGCGCACACAGGAGAACGAGGAACTA
GCTGCACTCAAGATGGCAGCTATGCTACCGATCAAACCGACGAGTaagcaacaggagcaagagcaggagAGCCGCAcgctgcaacaagaagcgcagCATT
TGAAGCAGGCAGCGGAGGCTATCCACAAGGATCAGGCCCGGATGAAAATCCAGGCAGTGTGTTTGAAGTATGTAGCTCGAAAGCGTCTTACCAAGTTGCA
ACAAGCACAGGTTGTAGTTATGGCTAGCATCCAAGACAAGGAACAGCGCTTGAGGGTCGGAgccgagcagcagaaagaaCTGGCACTCGCGAGGTTGAAA
GCTATGATGGACGACGAGGCTCGAGCTAGGGAACAGGAAATCAAAGAGCTTGAAGTCCAGATGCTTGAACGTGCTCAAAAAGAGAAGGAACGCATTGCTC
TACGCAATTCCGCCGCGAGGAAGATTCAGTCGCGAGCTCGTGGGTTCTTGGATCGCCAGCATGTTAAGGCCATCCAACGGAAGATTGAGAAGGAGCGCGA
GGATCGTGCGAAGGCAATGCAGGAGACGATCGAGGCAGCTGAAGCCAAGGTAGCTGAAGCTCTCATTGAAGCTGGTGACGTCGAGAtagcaggtgctgca
gcagacgacgtAGGTGAAGAAGCCCCGAAAGCCGACGAGTGGGTCGAGTACTGGGACGAAAACGCGCAGGCTTCGTACTTCTACAACATCCGCACACAGG
AGGCTAGCTGGACTCGACCCGTGTCGACGCCTTCAGCGAAGGCCATGGAGATTGTGATGGCAGCAACTGGACAGACAGCCGAACTCGAGCAGGAAGCAGC
CGCTGGGTATGTAGACTACGCTGCCACCGACAACGTGGACGAAAATGGTTATCCGGTCGCGGCTGAGAGCTACGCAGACGAGTACGGCTACTACGATCAG
TACGGTCAGTATCACTACTACGAGCAGAACAACGCTGGATATTACGGACCTCCAGCGTACGGACAGGGCTACACAGAGGGCTACGCACCGGTGATGGGGG
TgcagccaatgcagcagaattatgcagcagcggcagcagccaacTATGCGTTCCAGGCggctgcagcgatggcgtACAACCAAGCCATGATGTATGGGAA
TTCAATGATGGCCTACTCAAATCCAGCGATGACCCAACCAGCCCAGCAATACCCTCCAGCAGCGGAACCAGTAATGCCGCTTCAACAGGAGGCGgaagca
gttgctggagacaCTGGAGGCGCCGTTCCGCCCGATCCTTGGGAAAAGTTCTTCGACCAATACACTGGTGCAGCGTACTATTACAACAGCATCACAGGAG
AACAGTACTGGGCGTAGCATGAGTAAGTCCAATTGcggtcagcagcagctacttgCTGTATAAAGTATTATTATGTTAGTGACAGGCAATCGCCTTTCAT
TCGTCCACATTCATCATGGAACTGTCATCGGAGAAGTCCAGGCTCGAACACGCAAGTGACTGCCTGCTCCGCTCAATACTGCTATATGACTGGTCCAAGC
GCCGCGAGAGATGTGTACTGTCTTCGAGCCCCGCTCGGCGGCGAGCTGTAAGGGCCATTGGAGTGAGACCACTAGTCTTCGGCGCATTCTTCACGGGCTC
CGAAAATTCAGGAAATGATCCAGAATCGGCTGAGAGCGATTCCTCGAACGCCACCGTGATCATTGAGCCTGCAAGCGTGTCCTCAGGAGAGTAAGCCAGA
GCCTACAACAACGTATCAAATAGGAGTAAGTATCACATGGTACCAGCCAATTTGTGCTGCAGGCAAAACTAGTCATCATAATGGCGTTTGTACCG