Description :
From Genome Similarity Track
Location :
Scaffold_754:6019- 7266
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_754-fgenesh-gene-0.0Ubiquitin carboxyl-terminal hydrolase
Pytir_DAOMBR486fgenesh_masked-pir_contig_754-abinit-gene-0.11Chromosome-associated kinesin KIF4

Sequence
1247 bases(100 bases per row)
GACATCCAGCAGTTCCTGGCGAAGAAGAGCGAGGAGAAGGCAAAGGCGCAGCGTGCCAAGTACTCTTCAGTTTCGTCCAGCGGCGGCGGATACCACTATC
AGAAGCCGAAGGAGGCCGCGCTAGTGATCCGCACCAAGTCGCGATCGAGCGAGAAGGAGAAGAAAGGCGGCGGCGGCGGCAGCAACGCGAGCAGCAGCGG
CCCGACCGGCAACGGCGTGAGCATCCGCACGCCGACGCGAAAAACAGTGCGCGTGGCGAACGCAGCGGGCTCGGACACGGACGAAGAAGACGACGGCGGT
GACGATTACATCGACAAGTCGGACTCGATCGACGCGATGGCGGACTTGGACCTGTTTGACGACACCACGCGGGGATACTCCAGCTAAGATCATCGAAGTC
GGTTCGTTTGTCGGAGCTTTCATCAGAGCAAGAGGCGCACGAAAGCCACGAGCTAAGTTGAACACGCCAGCGAAATAATGCAAAAAGGAAATCCAGTGAG
TGAAACTTTGGGTCGAGTCTTTTTCAAACTTGACTTGTACTGGCACAACATAAAAGGAATGGATGGTTGCTTTGCGCCTCGATCACAAGAAGCGAGAGAT
CCTGCTCGCAGTGCTACTGGACTTGTTGCTGTTAGTATTGCTGCTGGTGGCAAGAACGTTGTTGCTGGTGGGCTTGAACAAGAATCCACGGCTGGGCTTC
TTCAAGAGACTCGTCGGCGTAGGCGGATGCAACTTCGTCTTCTGCGCACTGCCTACCTGCAGCATCTTGCTGTCGTTCTGCGACCAGAGTTTCTTGAGCT
TGGACGGCGCAGGATGCTCGTTTTCCTTGTCAACACCAACACCAACATAAAAGAACGATTCGACTTCATTTGCTTTATCATCGAGCTCCGACTTCTTGTT
CTTCTTCTTTACCCCTTCGAAGCCTTCACGGTTGTGGCACTTGGAGGCGTTGCACGCGCAGCCGCTGCCGCACTTTTGCTTCTCTGCCTTGCACGCGCAG
GCTTTCGTGGCGCACTTGCCGTTGCATGAGCAGCAAAGCGGCATGCCAGCACGAGAAGGCGTCGCGAGCAGCTTGTCGATTTCGTCCATGATTCCACCAC
CGCCACCACTGCTACCGGTTCGTTGGCCTTTTCCAGTACCAGCTGATGGCGTTGTGGACGCTCTGCTTCTGCTTCTGCTCTTGGTTGTGCACCGCTTGCC
TTCGTCTTCAACGTAGTCTGAGTCGTCATCTTCGCTTTCTTCGTCCT