Description :
From Genome Similarity Track
Location :
Scaffold_428:6018- 9258
Transcript NameFunction/comments
Physo_125825hypothetical protein
Physo_125827hypothetical protein
Physo_125828hypothetical protein

Sequence
3240 bases(100 bases per row)
GGTGCCGTGTTTGATTCTCGATAATAAGGAAAATGAATTTTTACTTGGAGATGTTGTGCTGAAGGCTTTAGGAATCGATGTCGAGCGCCAATTGGAGCTG
CTAGCCACACCAAGAGGCGACGACGGAGATGACGATGAAGAAGTTCCTGAAGTAGCAGCAGGAGACAATGACGCGGAGGCGATTCGACAGGCAGTAGAGG
CAATGATCCAGCGTGCTCTGGATGAAGGCTTCCCTGCCGACAAAGTCGAGCGACTGCGCACGATTGTATACGCCTATGATGTCTGGAGGCTAGTTCTCGG
CGATGATCCACCTGGAAATGTGGAACCGATGAGAATTAGGATGAAGACGGGCTGTAGGCCGTACAAGGCGAAGGCTCGCTTGTATGCGCCCGAATACCAG
GCATTTCTTGAGTCGTTCAACGAGATGTTGGTGAAGCTCGGGTGGGTTTACGAGAACCCGACCAGCCGTTGGGCGTGTGCCGCGCTACCTGTGCGGAAGC
GTGGCGCTGGTGATTTTCGGCAGACTGTGGACTACAAACCTTTCAACGCACAGACTGAGCCTATGGCTGGACTAATGCCCAACTTGCACGTTGATTTGGA
GAATATGAGAGGCAGCAACCACTTTGGGTTCTTCGACTTCATTAAAGGCTACTGGCAGCTCCCACTTGCCAAAGAGTGCCAGGAGCTGTTGTCCTACATG
ACCCACCGGAAGATCTACACCCCAACACGAGTACCTCAAGGCAGTGCCGACGCTGCGTTGTATTTCCAGTCGGCCATTGAGCGGTGCTTTGCAGCACTGC
TGTACAAGCATTTGTTCGTCTGGATAGACGACTTACTGTTGTACGCCGCCGATATTGACACATACCTGGACAAGTTGCAGGAAATGCTTGAGTTGACGGC
CAAGTTCGGCTTCAAGTTGAGTGTTTCGAAGTCCTGCGTATATAAACGTGAGGTGAAGTGGTGTGGGAAAGTGATCAACGGTGAAGGTGTGAAGCATGAC
TCAAAGCGCATCCAGGCCTTACGGTCGATGCCCTACCCGACGAATGCCGGAGAACTCCAGCAGTTCTTGTGCTCTACGAACTGGATGAGAGACAGCATCG
TAGACTTTGCGCGATTAGCACGTCCTCGGTAGGACACACTGGACAAAGCGATGGCTCAGGCGTCAAGGCGAACGAAGCGTGCGGCTGCGGGTATACCGAT
CGCACTTACCGAGCAGGAAGGCGCAGCGTACGACGCGGTGAAGCAGGCTCTGGCTGATGCAGCCACCCTCGCGTTCCCAAAGCCGGATGCAGAGATGGTT
TTGCTGACGGACGCCTCAGACGTTGGATGGTCAGTGGTCGTGACGCAAGTGCCCAGTTGGAAAAGTGATGCAGACATCCAGGACCAGCAACATGAGCTGC
TTATCTGTCTTGGTGGTACTTTTACTGGAGCACAAAAAATTGGAGCGCTATCGAAAAAGAGGCCCTCCCTATCATCATGGCGCGCGACAAGCTGAGCTAC
TTGTTGTTGCAGCCGGGTGGCTCTCGCATGTACTGTTACCACCGCAACCTGATTCATGCGTTCGCGCCGGGTCGTGAGGTGAAGAAGCATGTTCGTGGCA
AGCTGTTGAGATGGTCCATGAAATTGATGGATTTTCGGTATACTATTGAGCATATCGATGGAGCACACAACGTGTGGGCTGATATGGTGTCTCGATGGGC
AGGCACACGACCCGCACCAAGTGTGGCAGTGAAGCGCGTCACACTGCGCCGCCAGCGTGATGAGGACCAGTCCGGTGACTCAACTAGTCGACCGAACGAC
CGACCGCGAATTCGGCCGTTCAGTGACGGCAACTTTGAATGGCCAACAGTTGAAGAGCTGCAAGAAGCTCAGCAGCGGCACATTGTCGACCGGCCACAAG
GCCTGACACGGAGTGATGCTGGTCTACTGTGTGGTAATGAACGGATTTGGGTTCCTAGTGCCGAAACGAGTCTGGTTCAACGACTTTTAGTGATCGCCCA
CTGTGGGGCGCAGGGTCACAGAGGCCGCGAAGCGCTGATGAACGTGGTGAACCGCAGGTTCCTCATACGGAATCTCTCCGCCCTAGTCAAGACTTTCCTT
GCTGGCTGCCTCATGTGCCAGCATGTAAAAGGGGGGGGAAGGTGGTGATGAGACCATGGGCAGAGACATTCCGATGCAGCGAACGAAATGGAGCTTTACA
TTGGGACTACCTACATCTTGGTGAATCATTTGGCGCCTTGCAGTACCTACTGGTGCTAAAGGATGATGCGACCCACTTTTGCGAGTTAGTGCCGTGTGCT
GTACCTACAGCAGCGGTGACAGCTGAAGCAATCCTCGACTGGCACAGCCGCTACGAAGTACCTCGGGTATGGATAAGCGACCAGGGCACCCACTTCAAGA
ACCAAGTGGTGGCCGAGGTGGCGAGACGTCTTACCTGTGGGCAGCGCTTTACGGTGGCATACAGTCCGTGGACTAATGGGTCAATTGAGAGAGTCAACAG
GGACATTGTCCAGGTCCTCCGCGCTATGTGCCTCTGGACATTCGTGATTGGGTACATTTTGATCCAGTGGTACAGTCGAACTTAAACCACGCACCAGTTC
CGTCGCTAGGCAACAAAGCACCAGTGGAGTTGTTCTGCGTCCTCCCGGCTGCATCCCCGCTAGACTTTGGATTCAACGGCGAGGACAACACATTCCTAGA
GCTCGGTACAACTAGCAGCCAGATAGAAGCAAAGCTGGCGCTGCTGCGTGCCGGGGTGCAAGAGATGCACAAGCGAGTGCAAGTGGCAAGGTCGGAACAA
ACAAAACAGAATCAGAAAACGCAAAGACTAGCCAGAGTGGCGAATTTCGATGTCGGTGACTACGTGTTGCGGTCTCGAGTGGACCAAAAACACAATGACA
AGCTGCTTGTCACTTGGATAGGCCCGTATCAGATCGTTGGTGCAGACGAACACTCTTTCCGCGTGCAGCACCTAGTGACTGGCGCGGAATCAGACGTACA
TGCCTCACGCCTTAAGTTCTACGCGGACGCGTCCTTCGAGGTAACGGAGGAGATTCGTGAGCACGTGGCTGCTCAAGGCATTGTCCTGACCGTTGCTGAG
CTGAAAGAGCACCGGTGGAACTCGGCGAAGAGGTGTTACGAGATACTGGTTGGGTGGAAGGGTCTGGAGCCAATTGAGGACTCGTGGGAGTCGCTCAGTT
CACTGTACAAGGATATCCCTGTGATGGTGAGGCAGTACGT