Description :
From Genome Similarity Track
Location :
Scaffold_89:60175- 61406
Sequence
1231 bases(100 bases per row)
GGCTCGTATCTTCTGAGCCAAGGTAATCCCAGGATGATATCAAATTGGTCATCCAGATCCAGTACGATGAAATCATCATCGTACTGTTCACCCTCTGACG
TGTAGTGGATTCCAACTACACGTTTCGCAACGGTTATCGACGCACCTGTAGCAAGGAACACCGTCATCATCGTTTGAGGGATGTCGCGCTCAACGAACTT
GAGCCTACGACCCTCTATCGACTGACGACGAACAAAGTTGTTCGACGCCCCACAGTTGACTAGAGCACGAAGTGACAATTCATTTTTCACTTGCAACTTC
AAGGTGATGAGTGATATCTCATCACCAGGTGCAGAGACACACAATGATTGTGTATCTGGAGCAACATTCGTCATGAGATTTGCAAATTCTCTTGAGGTTG
CTGGATCAGTAGGGCGATCCGCCTCTACTGACCCTGACCATTTTTTATGGTCCGCTTCGCTGTTGCGGTTTCGCAACAGCGTTGGACCTACGCCGTTTGC
CCTCTTGGCAAATAGCCAATCATTTCTCTCTGTACTGTTTGGTACTGAGCGTGGGGCACTACTCTTAAGCGTAGTGCCCAAACTTCTGGCAGCGGTTGCA
CTTCTGGAATCGCTTGTTGTTTAAAGAGCGAGATCTCTCGCTCTCAACATAACAGAGGTCCATTGGTTCTGAACCTCCAGTCTCTTGTCGTCTCGGTGGA
CGATAAGAGCTCGAGCTAGCATGAGCCTGCCTCATGCTAAAGTCCTCCTGTTCCGCAGCTGAGATTGCTTGTTCAAGCGTACCCAACTCTAAGCGGAACA
GGTGGTTCCTGATGGGCCCATTTACGAGCCCTTGCATGAACACAGTAATCAATGTGTGTTCATGGACTGGGTTAGCAATTATACTACTCGCGAGGAGTCG
TATATGCTGAGCGTAAGCGTGCACATCACGCTTACCGTGCTTGAGTTTCAGAAGCTCTGACTGAGCCCTTAACTCAGCTCTTGGCGGCTCAAACAGACGT
TTGAGCCGGGTTTTAAAGGCTTCCAGCGACCCAAAAGCATATGGGTCGCTCTTCTCCAGCCCTAAAGCCCAAGTCTTGGCACGCCCCGCCAAGTGGGTTA
GAGCAAATGTGAGTTTATTTACTCATCGTCGATACGTCGTGCCTTTATGGCTCTGTCTAATTCGACGAACCATAAAAACAGGGAGTCTTCCTCGACTCCT
CTGTACTTGGAGATATCAACCTTAAAGATTT