Description :
From Genome Similarity Track
Location :
Scaffold_15:6016- 7571
Transcript NameFunction/comments
Physo_131231reverse transcriptase
Physo_131232hypothetical protein

Sequence
1555 bases(100 bases per row)
CTCGGAAAACCTCGTCGCGACGTACCCGTTCCAGGTCATTGCCATGGACTATATTCCGTCGTTGCCGGCATCCTACAAAGGCAACACAGAGCTGTTAGTC
TGGGTCGCCCTCTTCACGGGGTTCGTCGTGGTCAAAGCGAACGCGTCACGAACCGCGCAGACGGTGGCCGAGGCGTACGAGGAGGGGGTGTTTATGCGCT
TCGGCGCGAGCGAGGCTATCTGCCACGACCGCGAGCCGGGCTTCATGTCCGACTTCTTCAAGGCGTTCAGCAAACTCATGGGTCAGAGACAGCGAGCGAC
GCTCGCTTATCGTCCCCAAGCTAACGGTGCTGCAGAACGGATGGTGCAGACGGTTACAAGAGCGATCAAGATGTACATTGGGGATGTCGACCAACGCGAC
TGGGACGAATACGCCGAGCGTCTTACCTTCGCGCTAAACACGTCGCACGACCGACAAGGAACGAAACCCCGTTCTTCTTAGTGCACGGCTGGGATCCTCG
GTCGACGCTGGAAGCAACGCTGGCCGTCGGGAACACGTCGACCCGGGACGCCGAGGCGCGGCGGTGGAGGCTCCGTATTCAGCGACACTACAAGGTGGCA
AGGGCACAAGCGTTGGAGTTAGTCCGAGAGGCCGTCGAAGAGAGAGGCGTCGACAAACTGAAAACGCGACGCAACATGAGATCGCGACGGGCTCGCAAGT
TTGGCTGTACCTGGATCGGGTGAAGCTGGGGTATGCGCGCAAACTCGCGCACATGTGGCACGGACCCTTCCGCGTCGCCGAGCTGGTCAGCGCGTTCGCA
GTGCGCCTCGAGACGGCGGGCACGCCCTATCAGCTGTACCTCGTCGTCCACATCTCCAAGCTGAAGCCCGTCCGGGAATTCCCGTCGCGACCCGCGACGC
AGCTGACGGTGCCGGCCGAGGAGCGCTTCGACTTCGACGAGGAGCTCTTGCCGGAGGATAGCTGGGAAGCCACGCGCGAGCTGGAGGACGACGCCTTCGA
GGTCGAGAAGATCGTGAACGTGCGCGAGGGGCGGGCTACCCGGTATGGGCGCACGCGACGCAAGTTCGAAGTCAAATGGAAAGGCTACCCGGACACAACG
TGGGTCGACGAGCTCGATCTGAATTGCGGCGGGTTGCTGTACGACTTCCTGCGCCAGCGCACGGGACGCAACCGGTTCGAGGCGATGCAGTCGCACGAGA
ACGCGGAGGCGGTGGAGCCTGGTGGGTGAGCGCCCGCGGGTGCGACTAAGTCGGCGGGGGGGGGGGGGGGCTGCCGACGGGAGGACTGGCGGGAAGCCTC
GACTCTGGGAATGGCCGGAGCGAGGGCTTGGATGAGGGAAGTGAGGAGGACCAGCCTGTTGCTGAAGGTGGGACGGCGGAGCGCCGTCTCATAAAAGATG
TGGAGAAGTGGAAAGAAACAAGGGAAAAGAGCAAGGCTACGTGTTGAAGTTACGGCTACAACAACTAAACGCGACGGACTGTGACGATGGGCCAGACTCA
AACCTGCTGGACAAACTTACCTGCAAGACGCGGCACATAGAAGGCGGGGTGATCG