Description :
From Genome Similarity Track
Location :
Scaffold_439:6014- 12201
Sequence
6187 bases(100 bases per row)
CGGTTTTCTTCCTTGCGACTACGCTTCTCATCTCGGCGGCTCTGATCCTTCCGCTTGTCATCTCGGCCTCGTGCGATCCTGAGTCGGTCGCGTTGCTTCT
TGCGCTTCTCGCCGAGGATCCGACGATTGATTATCTGTTCCACCTTACTGATGTCTCCCAACTGCAAGGGGTACATCAAATCCATCACATCGTCATCACC
ACAATGCAGCAAGAAGTGTTCGACATGGTCAGCTGCGTCGGCGCCACCCTTCTCGTACTGGATCTTGGCTGTCCGAGCATACCCGTTGAGTCGGATCAGG
AAGTCGCAGATCGGTTCGTTGACTTTACGTCTCGCCGAGTAGTAACGAGTGCGGGCGGATTGGTCGAGCTGTGAGCAATAATAATCCAGGAACGCCTCGC
TGAGTAGTTTCCAACGTCGCTGAGTCTTCTTCGGCAGCTGCCTGTACCAACTCTTCGCCGCACGTCCCAAGCATAGCGAGAAAGGCTCGCACCATGCACT
TTGGGGCATCCTGGTGCTCTTCATCTCGTAGATGAAACGCTTGAGCCACTGGAGCGACGCGTCAGAGCGGTAGCGCTTTCCTTCGAACTCGGCGATTTTG
TCGAGCGAGGCGTGGGTTCGGACTTCGAGGTACTGCGTCGAGTCCTCTTCAGCCGCGTCAAAGCTCAATGTGGTGTAGGGATTTCCAGATTCGACCATAC
GCCGACCTACTTTAGGTCAAGAATCGGCTCGGTCTGATAAACCAGAGCTTAGGAACAAAGGATCACGGTAAGTACTCGGCGATCTGTCCGGATATGCTAT
CCGGATAGCCGCTGAGCTCAACGGCCGCCTGAAGAGTCGGTAGAGATCCGAAACGACTACATTTCACTAGATATTTGTATGAGAAGCATAGGATTAAATA
GGAGGAGCCGAAAGGGCTCCCAGAAGATAACAGAGCAGAATTTTCCTAGTCCAAGACACGTGTACACTTTTCCGGTAAGTCCCTGCATAGGGCTGGATTA
TGCCTGCCGTCAATACTCGAGAGGCATAGCTTGTAGGGTATTGACTGGTAGCGCCAAGAGATTAGGTCGGTCCGGGTAGGACAAAGTCTCGCTACGCGCG
AAAGAAAGTCCCGCATACTCAGCGGGCCGGTACGTCGGATAGCCCGGGTGCCGTAACACTTCTAGCTGAGCTGCCTCTGCGCTCGGTGACCTGTAAAAGC
GCTCGCGCGCCGTCGTCCATCCTTTGGTGGAGGGCACAGGGTTGTGAACGAGCTCAGCCGAACCAAACTCGGCGGAGCCTCGGAAGTGATCTGACTTGGT
TAGTCGGAACCGGGTGGAAGCGAGCCACTCGTCTGTCCCGGAAGGGCCGGACCGCGAGGGGACCACCCTCTGCGCAGGCCATACAAACCGCCGACCTAAC
TCGGCGATTCGTTGTGGTTTGTGTAAGGAATCCACATCTGACGATATTTGTGTGTTCTACTACACCACAACTCCCCGTCGTCGCTGAATCCGCGGAGATG
GCTCCTGCTGCTCCTCCTGCCCCAGCTGGTGGTCCACCACCACTCACCGAAGATTCGCTGCGCGCCATGCTGGCTGAAAGTACGGAGGNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTACCGGC
GGTTGCAGCTAGAAACAACACATTCAAGTGAAGAACTGTTCCACGCCTCTTCTGGTTGGCTTAGCAGGTTCAACGATAGATTCAACCTCGTTTCTCGGCG
CCATACTACCACGAGAACGCTACCGGCCGACGCAAAAGACATGTGTACACAGTTCATCCAGAAATCACAGCAACTAATTGAGCAGCACAATATCAAACCA
TGAAACGTGCTCAACATGGATCAGGTACCTCGGTACTTTGAAATTGAACCAAAGAGAGCCATTACGACGAGAGGCAGAAGAGAAGTGATACTTCGCAAGG
GCGGTAGCATCCACAAGCGTTTCACAGCTACCTTTACGATTACGGGGGCTGGAAAGATTTTAAAACCTCACGTTCTGTTTTCTAAGTTGAAGAAGAAACC
TCGAGTTGCCGACGGTGTTTTAGTGGACGTGAAACTCCACCGGTATGTGGAACGACGACATCTTATTGCAGCATGCCAACGACGTTATCTGTAGCAGAAA
ACAAACGAAGTTTTTTTAAGGAACCTGTCCTGTACGTGATTGACTCCTACGCTTGCCATGTCAAGCTATTCGATGAACAGCGTCTAGCGCGCCACAATAT
TCATGTGTTGCTGGTGCCGCCCAATCTGACCAACATGTTGCAACCTCTCGATGTTTCTATTAATAGAAGCTTTCAGACCTTTTATCCCGAGAAATACGAC
ACATACATTGGGAGTGCTCTCGAGGATACCAGTCTCCAGACTAAAGCAGGTAATCCTAAAGTTCCCAGCTACCGCTCTGTTTCTCAATGGATTCTCGACT
GGATAGAAACTAAGACAACAGCAGACATCCAACAGGCGCTCCAGCTGTGTGGCCTCGTACGGCGATCTGAATTCTCGATGCGTGAGCTTCACCTTCCGTT
GCGAGAGCTTTTAACTTCCTCTATTGACCTTCACGATTGGCATGTTCGCTACCAACACCTACTGCACGAAATCGACGACAGAGAGGAGCTCATTATCCAG
CAACCATCTTGGTATCTTCCTGAAGATATTCGATCAAGTTTGTTTCTATGCCTCCGTCACAGTTTAGTGAGCTGGATTCCTGACTACGTTACTGTCTTAA
CAGAGCACATGATGAAATTGGAGGAGCTGGACGGGCTGTTTGATGATGGCTACATTACTGACGTCCGAAATGGTGATATCGACGGAGGAGAACTTGAACT
TTTCGCTGCGTCTCACTTTCATTGCTGCAATATTGAAGTGAAAACACTCGACGAAGACTGCAAGGTAGTTTCCACGTATACATACGATGTTTCAGGAGCA
ACTCAAACGGTTTGTCTCGCTCAACTGGGGCCTTACTATACATTGAGGGTCGATGGAATGCACGTATAATAGGTATTGACAATGTTCACTTCAATTTCTT
CCAAGTTTTCATATAATACTGCAATTGAACGCCTAGGCGTTCTAATGGAATAGAACGCTCAGTGTACCTACAATTTTATTTGAAGGCCTAGGCGGTTGAT
GCGGGGTAAGACGGTAGCTTAATGGATTTGTACTTTTTATAGACATTAAGGTATTATGGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN