Description :
From Genome Similarity Track
Location :
Scaffold_35:601341- 602356
Transcript NameFunction/comments
Phypa_INRA-310PPTG_12756polyribonucleotide nucleotidyltransferase

Sequence
1015 bases(100 bases per row)
CTAGTAGTACACTCCGCGACAGGATGGATCGGCCACCCACGTCGGTGGCCGTAACTTCGTCAATTTTAGGAGTTGGAGGGCGCTATTTAGATATGTTTTA
GAGGTAATTTAGGGCAAGGCGGTGTTTGTGCTAACGAGCAAGAATTGGCAGTCTATCGAGTGGCTAGCATAGAGAGCAACGGTTTTCGCACTACGACAGA
TTAGATCGGCCACCTCCACCATACAAAAATCAAGTATATTTGTACCTCAATAATGGGTCCTATTTCCTTTCTTATCGAGAACTTCTAGGCATCGGCGCGG
CATGAACTCGATTAGCGACTCCAGCAGAGCGGTGGGTATTGAATCCCACGCCTCAAAGAGCGCAGCAGTAAGCTCTGCTACGCTATCAAATTGTTTTCCA
TTATTATATACCCTTCTACTCATTATAGACCACAAGTTTTCTATGGGGTTCAGGTCTGGAGACTTGGACGGCCAGTCTAATACCTGAACTTCTTGCTCTT
GAAAAAACTCTTTTGTGCGCTTGGACGCGTGAATGCTTGCATTGTCCTGCTGATAGATGTAGTCCGTCCCATAGTTTAGATGCGCGAAGGGGAGAAGAAA
CTCAGAGACAGTGTAGATATAATCTTCTGAGTTTTGTCTCCCCTTCAGCACAACTAGCTGCAACTTTCCGTGCTTAGAAAACGCGGCCCAAACCATCACA
GAGCCCCCTCCTGCTTGACGTCCTCTTGGTTTGCCGGGGAGGCTTTCTTGGGTCCCTCCAGTAGTGCTGAAAGCCGTCGGGGCCGTCTAGGTTCCACTTC
TTCTCGTCTGAGAAGATGATGGTGTCCCAGACGACCCCGGCGTCTTTCCGCACTAGCATGGCACCGGCCCATGCCTTACGGGCAGCCATGTCCTCAGGCT
TAAGAGGCAATGTGTTCTCCATCTTTGTGTACACCAACCAGTCCACCCTAGAAAGGGTTCGCTGGATGGTGCGCACCGAGACGGAGAGCTGCAGCTCGGC
CTTGAGCTTGGCGGC