Description :
From Genome Similarity Track
Location :
Scaffold_1073:6013- 10785
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1073-snap-gene-0.3Conserved gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_1073-snap-gene-0.5Glycoside-Pentoside-Hexuronide (GPH):Cation Symporter Family

Sequence
4772 bases(100 bases per row)
ATGGAGAGGGGATACCGACAGGATGAGCGCGAGCGTGCGCGCTTTGAGGCGGGTGTGCCAGGACGTCGTCAATCCAATTTCCACGACAACAGCATTGTTA
ACAACCAGCAGCAACCAGTGGTCCCACACCTGGCAGACAAGTACGAACCTGGGCACCCGGATGCGGACTGGGGCGGATTCGTCCAGCGGTCCTACAAGAA
GCGCTTCTATGACGACCACGCGTCTGCGAAAGATGTGAGTTGGTCTATGAATTTAATTTGTGCGAGCGGGGTTGTCAGTTGGAACTCTAACACTGATCTG
CACCTTCTTTTTTTTGTGTAGAACCTTGCGTACGATGGCAAAGGAGGACTCATGCCCGATGGATCTGCTGCGATCTCCAACACAGTCGGGCGGAAACTTT
TTGAGCCACACCAAGTGCCTTTAGGAGACACGGTACGTCCTTTACTCATGGACATTCAATGTTCTTGGACTTCTCAATGACTAGAGTGGGATCGCTTGCA
TTGCATATAAACTAGACCGTCCCTGGTATCCCGTTCCAGAGCGCCGTGTACCAGGTGAGAGGACTCCACTGCAACTAAGAGTCGCAATATGGCTGGCTGA
CGGTTAACCTGTTGCTGATTGACGAAATAGGTCGGACCAGGGTGTGAAGCCAACGCCTCTGACTGGAAAACGTACGTTGTGTGCTGCCAAGTCGAGTTTC
ACTCCTTTATAATCATAGCTCACGGGATTTCAAACGTGTCTAGGAGCTACGCATCCCAGACATCCATGGAGGCGACGCCAAAGGATGTGTATGCGCTGGG
CACGAGAAACAATTCCCAGCACAAGCGCCACGTGACCCCACTGGTAAGTGTCGTGATTTATATACCATCTCTATACCGTCGAATGATGCTGAATTGGTGA
AATTTGCTATATTGCAGTACGAGAAATCGTTTCACGAGCGAAAGAGCTCTGGACGGAGCGTCTCGCCATACTTTGAGGAATCTGGACTGAGCAACAACAA
CAGCAGCAGCAGTGGGAGCACGGGGTCGCTCTCGGGCAGACGAGTGGGCTCCCAGCGGTCGCTGCTCGCTGGGATCGGGAAATTGGTCGCAGCAGAAGAC
TTTGGCGAAAAGCTCATGTACGTTCCGTATCTATGCTCTATTAACGTCTATTGGCCTCTGATAATGCAGTTTTTTTGCTCGTGGCGAATGTAGAAGTCCA
GAGCTCCACCTCTCGCAAAGCTACACGGATCCGTCGCAAAAGACGCTTCTTGCAGAGAACTAGTACGTGCTTCGTAGATCAGTGAGCGACAATTACGAGT
GTGATTCTGACACTTATACATAACCTTCATGCTGTGTATGATCAACAGCCACGGCGTGAAACTCGGATACACTGGCCGAAGAAGGTTCTGACTCCACAAG
CCCCAATTGGTTGATAACCATTTCAACTGAGTGCCGATTGGTTGTGCGAGAGGATTGGGACGTCAACGAGAATCTGAGGTCGAACTCTGTGGCGAAAACA
TGGATTTCGTTATGGGATATCACCTTTTTACTCTGTATACTTGTCGTTGCTCTCACTTGTTTGCCTCTGTAGCCTGCCATCACCAGTCACCACAGTTCCT
GACGACCTCTGCGCCTACATGGAGTACATCTTGACCCGGAAGAAGAAGAGGCTGATGATGACTCCGAGGAACGAGATCGCGCCGCCAACGAACACTGGGA
GCGCGTATCCGAGCGCCGTCTCGACGAGCGCGGCGCTCGCAACAAAGTTGAGCAGCTGGCCGAGGCAGTTGGCCGAGTTCACAGCGCCCACGTGCATGCC
GACCTCGGCGCCATCGCCAAAGACGTGGATCAGGAGCGGCACGATGAGCGCGAAGCTCGTGGCCTGCGTGATGGATGTGAGCGCGACGATGACGACGTTG
AGCGGCACGGACTTGGAGAACGCCATGGCCATGAGCAGCGTCTGCGGGATCCCGCCCAGCGTCATGGTCCAGCGCGCGCCCAGGCGGCAGACCAGGAACG
GTAGCACCCACGAGTAGACGTAGCCAACGATGTTGAAGACCATGTCGGCGAGTCCTCCCGCGAGCTGCACGCCTTTGTTGTACTGCTGCTGTTCATGCGA
GCAGTGCAGCTTGCACGTGTCGGCGTTGTTCGCGTCACCGTGGAAGACCTCGACGCCGAAGAACTGACCCTTACTGCCGTTGTAGGCCGTGAAGCCGTAC
TGGACCGTGAAGAACACGACGCAGTAGACCACGAGCACGCTCGGAAGCGTCCGGAGGCCGTGGATGATAGTGCCAAACGCGTGCACGATGCGTCGGTAGG
TCGTCACGAGGTCATCCTGCGGGTCCTTGGCGCGCGGTATCTCCTTGGCGAAGAGGCACACGGCGCCCACAGTCGTGACCATCGTAACCGAGAGCATACC
CAGGAACCAGCGCAGCGTGAGGTGGGCCGCGCCAAAGCAGTAGATGTACCCGGCGATCATGATGGAGCCGAGCGTCGAGCTCGCCTGACCAATGCCCGCG
CCGAGTGTCTGTCGGTCGCCGGCAAAGTCGGCGATGATCAAGATCGCGGGCGTCTGCACGACGTTGACCGTGACGTCCATCCACGTGTAGAAGAAGATCG
TGAGCAGCGACGTCCAGAGGCGGCTCTCGTCGTCCTTGTCGCCCAGTAACTCGCCGAGCTTGCGCGTGTAGCCCATCATGGTCCAGCAGATTGCGCTCGT
GATCGCGCCGTAGAGCAGGTATGGACGACGGCGGCCCCAGCGGTTCGTGCTGCGGTCGCTCAGCACGCCGATCGTCGGCGCTACGAGGATGCCCGAGAGC
GGACCGATGACCTGCGTGAGCTGCACGGCGTACGGTGGCAGCATCGTGCCCAGGTACGGCCCCAAGGCGGCCCATTGCGCCGCCCAGGCCATGTTGGTGG
CCATCCGCGGCAGCGAGAGCAGCACGAGCATGGCGACCGAGCAGCCGCGACGCGACGCACCGCCGTCAACGGTGTCTTGGAGAAGGAGGCCGTCCTGGAC
GAGCACGACCGAGTCGCTCTTGGCCGGAGGCGAGTCCACGCGGTCGTACAAGGGCGTGCCTTGGTGCTCACGCTCGTGGGTCATAGCGAAAAATTGGTCG
GGTGGAAATGCTGGAGTCGGGACTTGGACGCGTGTTGGAGAGTGAGCTGCGAGTGACAGTTGGAGACCGAACGCCATCAGCAGCACTGGCCAGCCACTCG
CCTCGTCGGCGTTTTAGGCGACTCATGTGCTATCGTCGTACAGGAAGGAGGTCAGTTGATTTTGTTGGTTTTGAAGCAACGGAGCAAGACCTGAGAACAA
AGTCGACCGTTCCTCGCATCGTCCAGCGCGCTGACATCCGAGACATGGCCACGCGTCCAAGTGCGAAGTCGATGGACGCCTATATGCTCGGCACAAGCTG
GTGGAGCTCTCACGCCATGCTGTTGTTACATTGTCTCCCCTAAAAAATCGGCGACGTCGTTGTAGCCTCGCGGCTTTGTCGTACCCGTCTCGCTGTCGCT
GCTAACTGGTTGTCCTATGCTCTGCTTTGATTGTCTCCTTCCCCCACACGTGTGGCTAGGAGGACAAGCTGTTCGGCGCCTTGCTCGCCGTGCGCTCTCG
CTCCTGCATGGCGAGTCGCATGCGCTCCTTCGTGCGGTCCTTGAGCGCCAGAAAGAACGCAATGTCGTCCTCGAGCTCGCTCAGCAGCTCGTGGTTGAGG
CCGTCGGACTGTGCGTCGCGGTAGGTCGTGCGCAGCTCTGCGAGGATCTGCAGCACCTCCTTCAGGTGGAGTGTGTCGCGATCGCGCTGGTCCATGAGCG
TGAGGTTCTCTGCCAGCAGCACCCGGTTCTTGCCGAGGCGGATAGACTCCATGAGCTGGTCACTCACGACCGTCCGGCACGAGCCGCAGAGCTGGGCGTC
GCCCACCGTCGCCGTGTTCTGAGTGTATGTGTTGGCGATGCCGCTGAGGATCTCGAGGTCCGTCGTCGTCGTTGTCGCCGTCGAGGTCGCTAAGGCCATC
GTCAAGCCGTTCGGGGGCTTGCACATTGGCGTGTACTGCATGGACAGCACGGGCTGCGCGCTCTCGTAGAAGCCAAAGTCCGCTGCTGTGTTGCCAGCCA
TGGACCCGAGTGCTAGGTTATTGCCACCACCGGTGGGCGTGCTGTGACCCTGCGGCTGTAGGAGATGCTGCTGGGCGCCACTGGTCGACAGCTTCCGCTT
CTTCGCGAGACTCGGCAAGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNACCGCCTTCGCCGTCCTCCTCCTCCTCGCCCTGTCGCTTCGCAAAGTCGTGGTCGCGAATAGCTACCAGATTGCTATTGCCATTGG
CAGCGCCGTGGCCATTACTGCTGAGATTAAGGTTCCCGGCCGTGCCGTCAAACTTGCGCAGCAGCAGGATGTAGCCGTTCTTGTTGTCGTTCGCGAGGGG
CCCTTTCTTGATGGGCCGGATGCCGCGTCGGTAGCACTCGGCGCGCAACACGTGGGCGCGCAGGCTTTCGTAGGGCTCGAGCACCTGGCGCAGCTTCTCG
TCCGGTACTGCTGTTGCTGCTGTCGACGGCGCCGGTGGCTCGCCCGAGAGCAGCGAGTCGAGGTCTCCGCCG