Description :
From Genome Similarity Track
Location :
Scaffold_979:6012- 7696
Transcript NameFunction/comments
Phypl_g11903conserved hypothetical protein

Sequence
1684 bases(100 bases per row)
TCAATGTCTTCGGAAATGTAGACTCTATTTCGACGTATCATGACGACAACGCTCATTCTCCAGCAGAACGTGCTTATGAGCTTGAGGCTCGCATAAATGG
TCTATTACTACAAAATAATTAACGTCATGTTCATTCACCAAGCCCGCTAGAAGAAAAAAATGATGCAAACCGCCAGAGTCCGCGTCAATACACCGATGAA
AGTTGTGTCGCCTTCTTGAGATTGCAATCGCGCTTCAAAACAGGTTGCATGGCTAACAtcaactacttcgaagtTAGTGATGCTGGTAATCGATACCCTT
GCTGTCACATTGGTTGCTCGCAGAGCTCGATATGGATTCATAGTTGCCTTGGGCAAACAAATGCCTCACCGCTCAAAAGAGATGGAGAACTTACTGAAAG
GCGGTGGCGAAAATACAAGAAGCGGCTTCCAAATTCCAACAGCAGATCAACGGAGCGGCAGGAGGTGCATATCGCTGCTCTCCTAGCACTAAAACGGAAA
ATGCACAGCCCGGAACTAGGCTCGGAAGTCAGAAATCGCTGCATCATGCTGCGTTGGCCGGCATGCGGCACGATGGAGCGCAACGTTACCACCGCATGGT
CAGCCCTCTCTATCCTCGCTCCCGAGTCAACAAGACCAAGGCACGTCAACTTGTAAACGAACTGAGCCATTTTGACTCGGATCGGATTGGCACTTTGGAC
ATTTTGGGAACTTTAGACATCTATCATGACGGCAACACCTCCGCTTCCGGCGTCTCGTGTGTCGCTGGCGACACGAAAGGACCGCAGCGTCTATCTGCTG
CCTATCAACACGGTTTCTCATCAACACAAGCTAAAAGTCGAATTTTTCAGTGGGCGGGGCCCCAGTGGACTGAccgctcgagcagcgactACGCAGGGGG
GCCTTCGCCAGACCCTCCATCAGCTCGCGCAACTCACCGCTCTCGTCGCGAGCTCTCGCTCctcttcgagcagcgcccgaggctgctgcaggcggtaGTC
CcgcagcaactgcagcacttTGTGTTTGTCCATGCTCTTCATCCGAGGAGGACAAGTGGGTGTTGTTTCGGGAGTTGGTctcttcgccgtcgttgTTCCC
GCTAGGAACTTCATCAGATCCGgcctcagcagcttctgttGCTTCAGGAGGACGCTGGTCAAGACTACGccgctgcactcgctgaaATCGATCTTCAGGA
TCATACACGTAGATCGTGGTGCCTTGGACAGGTGTTGGttgtgaagctgctgacaCGGTAGGTCGAGTGGAGCTGACGGGTGGGAGAACCGGaggcgtcg
ctggaggcggcggtggcggggCCCTCCTTGACGGTCCCGAGTACGAGTTACGTGAGGGAAAAGGTGTCGAAGGCGTACTGTTGGACGGTGTTTCCGGTGG
CGAAGGTGATGGTGCAGTGCTGCTCGCTCCAGACCGTCGACGCGGAGGCACATGCGTAAGCTCGCTCGAGTTCATTACCCCTCGCAGACTGGCCACAAGA
TCAggcggagctcgagacgGCTCCGAGAGACGAGGTCCGTGCGTGCTGGGACCTCTCGATGAAGGGGAAACCATGACTGGACCTGGTGCGATAGCCACAT
GCTTGTGCTTCGGGGGTTGCGACGCGGGTCCTCTAGGCTGCTTCAGTGCCGGTAGAGGCTCAGACGActgtcgtcgatgaagcg