Description :
From Genome Similarity Track
Location :
Scaffold_30:601109- 602868
Transcript NameFunction/comments
Physo_108771predicted protein

Sequence
1759 bases(100 bases per row)
GAGGTCCTCGCGGAGTCGCTGCGCTCCAGTGTGAAGCAGCGAGGCGTGGCGGCCGTCGCGTCGCTCAAGCGCTCGTCCAAGTACTTGGCACACGTACAAA
AGATCCAGCAGTACGTGGATGTGGACGACGCCGCCGACGCTTCCGCGTCCTCAGCCAAGCCCCAGCCTCTGGAGGAAGGCAGCGCTGAGTACGAACTGGT
GGTGACGTCCAACGACCTGATGGTGCAGATCGACGACGAGATCGAGGCCGTGCACCGGTTCATCGCCGAGATTTACGCCGCCAAGTTCCCGGAGCTGGAC
TCGCTCGTGCCCAACGCTCTGGACTACGCCCGCGTGGTCAAGGTCATCGGCAACGAGATGGACTTGACAGTGGTGGAGGAGTTGCCCAAGTTGCTGCCCA
GTTCGGCGGTGATTGGAATCTCCGTGACTGGCTCGGGCACCAGTGGCAAACCGTTGGAACCCGAGGACTTGAAGACGTGCATGGAAGCTTGCGACGAGTT
GCTGTCGCTGGATAAGGACAAGAATATGATCCTGCGCTTCGTGGAGAGCCGCATGAAGTACTTGGCTCCGAACATGTCGCAACTGGTGGGCACACGTATT
GCGGCGCAGCTCATTGGACTTGCTGGTGGTGTGGCGCAGCTTGCACGTATTCCGTCGTGCAACTTGCAAGTGCTGGGGCAGGAGAAGAAGGTGCTCAGTG
GGTTTTCCTCGGCTGCGGCGTTGAAACATACGGGTGTCCTGTTCTTTTGCGATCTCGTGCAGAGTGTGCCTCCATACTTGCGCATGAAGGCGTGCCGGGG
TGTAGCTGGTAAGCTAGCCTTGATGGCACGCGTCGATAGCCAGCCTCACCAAAATGATACGGAGGGCCTAGTGGGCGCGCGCTTCCGCACCGAGCTTGCT
GGGAAGATGGAGAAGTGGCAGGAGCCGCAGAAGGCCAAGACCAAGAAGGCTCTGCCCATTCCCGACGAGAAACCGCGCCGGAAGCGTGGTGGCAAGCGCT
ACCGCAAGATGAAGGAGCGGCTGCAAATGACAGATGTGCGGCGTGAAATGAACCGTCAGTCTTTTGCAACCGCTGACGAAGAGTATGGTGACAACGCCAT
GGGAATTACGACCGGCCGTCTTGGCCAGGAAGGGTCAGGCAATTTGCGTATTATGCGCAAGGAGCAAAAGCAGTCGACCAAAAAGTTGCGCGCTGCAAAC
TTTGCCGCATCCTCTGCCAGCAAGCCTCCACTTTCTGGACTGGCATCGAGTCTTGCCTTCACACCTGTGCAGGGCATTGAGCTCATGAACCCCGAAGCTG
CGAAGGCACGTGTTGCCGAGGCAAACAAAAAGTATTTTTCTGCAGCTAGTGGATTCGTCAGTGTGGTCAAGAAGCCGTAACGGGGTGTAGATCAACTAAC
TTCCAGCGACGATATACATTGATTTGAATGCTCGAGACGTGGAGTTGTTGCCGTTTAGTCGGTGCGAAATCTCTTTACTTCCACTCCTCTGCTTCGTCAA
TGCGAAAGATCGTTATTACCACAGGTTCATGTTGCGTTCGGCCTGCAAAACGGGGCGTTGTGAAGGCTAAAAAAACGCTGACACAACAATAGGGAATGTA
GGCAAAACTTGCAGATTCTTCGCATCTGACACTGGTAATCAATCGGGTCTCAAGTCTTCTAAAGCAGCTCCCAGAATGATACCGTACCACTCAATTCAGC
ACCCACAATCTCCAACGTCGTGATGGATTGAGCTGGAAGATCCGCGGTGAATCTGGCGC