Description :
From Genome Similarity Track
Location :
Scaffold_519:6011- 8216
Sequence
2205 bases(100 bases per row)
ACCGAGTCTTCATCCGGCTCGTAGATCATTTCCTGGATGCGGTTCAGCGATGCCAATTCCGACTTGCGAGTTTCAGCCAAGATTACCCGACTGACCTTCG
ATTCCAGCGCTTCAGTGGCTAACGAATCCGCGGCCGCGTTGTATTCTCGTACAACGTGAAGATATTTACCTGATCGAAGCTTGGCCGTGAGTTCCTTGTG
AGTATTCAGCAGCGCTAGCAAAGTTTCCTTCCTGCATGCGATCACCCCAAGTGATTGTTGAATCGCGAGCCTTGAGTCCCCAACGATGACTAAATCCTCG
GCACCGTGCGCAATAGCAGCCTTGACACCGTTGATCATACCTTTATACTCTGCCTCATTCACCGTGGTAGCCGAGAGGTAAGCGTTTGCAGCAATCACTA
CCTTCCACTCAGGAAGGCTCCACAGCACCCATGAACAACTCCCGTAGCCACCGTACTTCTCTGTCTTCGCTGATCCGTCAAAAGACATGACGAATCCGCT
GTAATTACGGGAAAGCCTGGCGTACAGCAACGCGGGGTCCATTCGAATAGTCGGGGAACCCTTGTTTGGAGGCGCCACCGGCGCGAGCGAGTCTTCCAGG
TCAACGAAGCTCGTGATGCTTGACTGCAGTAGCTGCGCAAAGGCGACATCCTTCTCCTTCACGCGCTGCACCTTAAGGTGCCACTGCGATAGCAGCACTG
CGAACTGGACCGCGCGTCCGAAGAGAGACTTCGACTTATGCACCCACTCTAACGTCGAGAATCGTGTATAGACATGTAGCGTCTTTCCTGCTAGCTGGAC
GTAACAGATCTTCAACAGCAGAAGTAACGCCCAAACTTCCTTCTCAGCTGGATGGTAGTTCATCTCGGCTTTCTTAAGCACCCGACCGAGGAACCGTACG
GGGTGTAACTTGCCTCCATGTTCTTGCATTAGCGTAGTGCTCAACGCCCATTCATTCGCAAAGAGCATGACGTGAACTTCTTTCGATCGATCGAAGTGCC
TGAGGATGGGTGAATGTGAAACACTCGTCTTCAATCTTTCGAAGGAATGACGTGCCACAGAAAGGCCACCTTCAACGACAAAGTCTTCATCCTTGAGCTG
GTACAGCGCCGCACCGTAGACCGCGAAGTCTTGAATGAAGCGGCTGTAGTAATTAACCGCTCCAAGAAACGACTGCATGCCCTTCTTACTCGTTGGAAAC
GAAAGCTCGGTGATAGCCGCAAGCTTCTTGGGGTCAGCTCTGATACCTTCTGGCGAAATTTTATGCGACAGAAAGTCCACCTTGGGTTGGCAGAAGATGC
GCTTGGTGAAGCTAATGCTGATCCGACACTGTGCAAATCTTGCCAGCAATCGGTCCAGCGTCGCCAGGCAGCTGTCGAAATCCTCGCCACCGAAGCAAAT
GTCATCCACAAACGACCGTCGACCAAATACAGGTACCAGCGATGATTCGTCTGGCTCCCCGTTCGTAAACATGTCAGCGACGGGGCTGTTGACGAGTTGT
AGTACAGGGTCGGTCTCTACCGGTGCTTCGCGGTCTGCCGCGAACTTCGTTTGAAACGAACCCTCGGCGCTTGGTCCACGACGTTCCTTGGCCTGTTCTT
CAGCTAAACGCATCTTCTCCGAGTATTCAAACCAACCTCCTTTAGGCTGAACGAACCCCCAGAGTGCGTTGTCAATCATACGCTGATAGATCATCGGCGC
GTTCTTTAGCCCGAAGGGCATGCGTAACCACTCGAAATGTCCGAGTGCGCAGACGAACGCCGATACTTTACGCGCTCGCAAGGTCATCATGACCGCCCAG
AAGCCGCTTGCTGCATCCAGCGAGCAGAACCATAGGTAGCGCTCGAGATCTGTTAACAGGTCGTCGACTAGCGGCATTGCATACTCCATGATCGCAGTGA
TAGCATTCACCATCTTGTAATCAATGCAGAGCCGGATGTCCAGCCCGTTCTTTTTCATCACAATCACGATCGGCGATGCCCATGGACTGTCTGAAAAGAC
GATCAGTCCCGCACGCAATAAAGCGCGCAGCAGCTCGTACAACTTGCCGAGAAATCGTAGCGGCACGCGCCGGGCACGCTGTTTAATTGGGGCGTGCACC
TGTGTGTCGATATCGCATACCGCACGGTAGGCTGGCGGCGGTAGTGCGTTACCACTAGCAATCAGGATGTGCTCGTGGTTCTTTAGCGTCGCGACCAGAC
GCTCT