Description :
From Genome Similarity Track
Location :
Scaffold_878:601- 3839
Transcript NameFunction/comments
Phymu_g12242hypothetical protein

Sequence
3238 bases(100 bases per row)
ATCAGAACATCTATTGAAAGTATGAGTTAACCACCTTCGCGACGGTGCTGACATTCCCGAAGCGCCTATTCTCTTTCAAAAAAAGCACTGCTTAAAGGTG
TAGCGGCAAAATACCGTGACGGTGATGCGAAAGCGTATGCTTGACCCGGCTGAAGAACCGTTCGACGCTGTTTGAAGTCGGTGGGATAAACTTGACGCCC
GGGAATGTTTTCGGTTGCGCTCGAGCAAGCTTACGCTTCTTCGTTGCGCGATCGGCAAAGCTCTGCTTCGTTGACTGCACATCTTCGGCGTCGTTATTTT
CACCAACCGCAAACGGCTCGAGGAGGTCGCGCTGCTCCTCTGTCAGGTCTCCAGCCCTCGAACGAAGAACGGCGACACACGCTGCCTCAAATCCAGGGTT
CTTAACGATTGTGGCGTCGGTAGCAAGATAGCTTGAGACACTTGGGTAGGCTGCAACCAACTCGTCAAAAATGTCCCGAACATCCGAAAGTGTGACACCA
GCGTCGTGTTGCAGCATCATGGACGCGCTCTCGAAATCTTttagctgctggaagaggacgTCGAGTTTCTTTACTTTACTTCGAGAAGGCAGAAGCTCTG
ATAACCCTTCGTCAGCCTCCAGAAAATCTTGCAGCTCGAAAAAACGAGAAATCATCTAAACGTTGAAGACCAGCGAGTTTCTTGGCGCAGGACAGGCCGA
AGGCTGGTAAATTTGCTCGCCGCGGCATTCAGAGTGCGTAATTTTCGCATTAACACCTGAAGTTTCTCCAGCCCGTTCTCGTGCACTCCCATATAATCGT
TCACAGTCAGATTGGGCGGTAACTAGCACACCCAAAAAGTGGGACACCGAGCAAAGATGACACTTTTCCGTTCGTCGAGCATTGTCTCCAACGACGTAAA
TGATATCTTCAGTCGTTCGATTAAAGAACCCGAGAATGGGCGACAAAAAGAGGACGTGGCTCTCAGCTGTATGgtcttcgatctcgtcgtcaacAAGAGG
CGCAAAAACAAGGAGCACGGTCTCGGCTTGTTTGTCGTGCTCAAAACGGCAAACACGCCGACAAATTGTTCCGACTTGAAGGAGCAGTCGTCGAACACCA
AACCGAACTTAGGAGGCAGAGCGTCAGATACGTCCTTTTCTACCTGCTGACAGACGAGACGCACGTACTACAAGAACGTCTCCGTGCCAATAGGAGGAAT
CCCCACGCACTTGCTCACCGTAGCATTCTCAGGAAACGGAAACGGGAGGTTGAACTCGACCATTAGGTCGATCCAGTTGTAGATCATTTGACTCTTCGAA
TCAACGAAGGCTGTCAGAGCTACAGAGCGGCTGCTGGCAGCCATCTTCGCGGCGAAGTCAGGGTGCTCCTTGTGCACGTGGCCAGGCAGGTTGCTGTAGC
CAGTACCTCGAATATGCTTTCGCAGCGTGCCGCACTGGCATCGATAATGATCGTTGGGTTGGTTGTTGTCGTCcatgacgacgttgaagaagtaGGTGCA
AATGCTTTTGCTTGAGAACTTGACGGGCGACATTGCAGGGTGGGAGGGAGTCGTCGCTTTATGGAGCAGTTGGAAACTTTGGAAGTGATTATTGCAGCCA
ACACGTTGGTTAGATACTACGAGGACAGCGGTGGCCATTCGCTAGATGACCAGttatataaaaaaaaaacgtaaTTACACCGATTTAGACTATTTACGGA
GGGTGGACGTAATaaattattttttattaCGTAAATTTTCTCAAAATAAGTTTTTGTGAACTTGCAATACCGTAAAAATTGCAATACCGTTATTTATTCA
gagagcagcacaagctgtGCTGCTCGGCAGAGAGGTAACTTGCTCTGCGATGCACATTTACTGCGCATTGTCGATTCTGCTGCCTCAGGAGCACCCACAC
GCACCTCCAGAGCTCGTAGAGCACCATCTGAGGCAACACAGCACCTCCTAAGCCGGCACAACACAACCCGAGCCAGCACAGCACCTTCCTGAGTCAGCCG
AGCACCGCCAGAGCTCTACAACCCAACTGCAGACGGTGACAGATTCCCGTACGGCTGTTCAACTTCGTCCAGCTCACCGTGAGGACCTGGCAGATTGGTC
TGAGTCTCTGTAATTAAATGCCAGCCTCAGGGATCATGCCTTGGTCCCCACAGGTGGCCAGGAAGGACAGTTTGGTCTgtgggcagcagcttgtgaaGGC
TACGTCAATAACGCTAGCTACTACTGTGGCTGCAACTATTCAGCTGCCTCTAAGTGCACCTACGGATGTGTCATCGAGCCAATCAACATTACTAGAGCGA
GAACAGACCTCAGTGGAGGTAACTGCGGCAATAGTTCGGGTTACCGACAGCGTGGTGGTCCCTAATAGCTCTGAGATAGCTTCGCAGTCACTTTGCCGAG
GCACTAGACCTAGGAAGCCTCCAGCCCATATCGAGTCGGGTTTTTCAGTGCGGTCACAGCAAAAACGGCCTCGACGACCAAAGAAAAAATCAATTAGCGC
CACAAGTTTGGAAAGTTGGATACATCAAAGATAGCAAGATAACGACTATGGGTACTCTAGTCTAGACAGTCCTTTGGAGGACTCAGAAGCATGGCCGGCT
TCCTCGCACATGGGAACCACGGACCATGCTCCTCCAAGATGGTATTGGAGACGCAATTAAAGTCGTTGATGAGTGGGTCAATGGAGGGCGTGTTCAAGAT
TTTTTCCAGCTCGTCAGCGAACGGTACCCATCGATTGCTGGTGCCAACCCGACGGGTACATGCATGTTTCTCGCACTGCAACATGCATTACTGCTAGTGG
AAGACCCGTTTGGTGTTCGGAACTCCCATATTGATGAGTTCCTTTCTAGAGCTACGGAATTAAGACAAGACCTTTCTCGTGGAGTACCGTGGAAAATTTT
TCGAGCTTTTATTTtacagctacatgtaggtgGTTCTCGTCTATCATTGGAGGATATTGAGTACAACAGGCACCATACTGGACACCCTGGTGTCGCTGCC
ATAGTACGGTTGCCTTTAGAAGATGGTATCTACTTGGTTGCTGCCAGTAATACAATGGCAGTTGGACATGCATTTGTTCTCCAGGTCCGTGGAGCCCAGA
GGACAGTTTTTGACGACTCGTCTCAGCGCCTTTTGGACGACTACGGTGAGTGGATCGACAGAGTGATGTTCGTTCATAAAGTTGCATTTTTAGATTAAGT
TCTAAATATATTTTTCATTTTTACCTTCACTTTTGTTC