Description :
From Genome Similarity Track
Location :
Scaffold_1456:601- 1898
Transcript NameFunction/comments
Phyke_g11882putative polyprotein

Sequence
1297 bases(100 bases per row)
ACCGCGGCACATCCGGAGACGGATGGGCAGGCTGAACGTGTCAATCGCGTCCTTGAAGACGTGCTCCGAAGTTACGCGACGTCGCTCACAAGCTGGAGTT
CATTTTTGCCCCTTGCCGAATTTGCCTTGAACAATGACGAACACGCATCGACGGGGATAACTCCATTCTTTGTGAACTCCGCGCGACATCCGCGCGTCCC
TGCAATGCTTGCCGTGGACCACCCCACGGAACTTCGTGACTTCACCCTCGGTGGGGGAGGAGTAGCGTCTTCAAGTTTAACGCTGGACAAGACGACATCA
CCTGTATCTCCGAGTGAAGCCAGTGCCAATGCCGTGACGCGAgctcagaagaagaaaccctTGCTTCGCCGCGCAACGCGGCATCTCCACTCGCCGAATG
GACAGAACGAACACTGATCGACCCTGGCAGTGGCCCCATGATGCATCAACACAATGCGCCTCTCGCCAACTACGCGCTAAAGCCTGTGGCTGGTCCCGCC
GATCACTCGGCGGTTTCCGAGTTTGTACTGCAGCGACAAGCCATCTCGCGATTTGTGCGCGATgcactgcaagctgcagtggataAACAGAAGGAGAACG
CAGACAAGAACGGTCGCAAAAATGTGGATTCATTTCACACGGGTGACCGTGTGCTATTATCTACTGAAGGCATCCGACCCTCAGCTGTGACTAACCTAGG
TGTGAACAAACAAGCGCCGCGCTACGTCGGTCCGTTCAAAGTCACCAAGGTCATCGGCGACGCTTACAAGCTGGACATTCCGTCATCGCTGCGACTCCAC
CCGACGTTCTACGTCGGGCGCCTCAAGCGCTACCACCCGGCCGAGATTCCAGACTTCGGCCGCCAGGCACCTCTGGTGGAACATGCGTCGGACGTCCCTC
ACGACGAGCACGTCGCGCCATCGAGCCATCGGAACCAGGCGCCCGTTCACGTGGGCGTACCCCAGTCTGAGCTGAACCGAAGACATGACTCTCCAGAGTC
CGCAGCCGCGACACAAGCTCGCGATTCGACTGTCGAAGCTACGACGCCGTCTGCTGTGCATCCCAAGCCTCCCTCGCAGCTCGCTCAGCCTCCAGCTGAG
TGTCCGCAGCGCGATTCACGGCCATGTCAACCTCATGTTGAGCAACCAAGGCGTGAGCCGTATCGGCGCGAGGGGTCTCCACCGATTGTTGATTCGGCGG
GCGACACTTGCTGGGTCTTGGACCGTATCGTTGcgtgtagcagggctacacaagtatacatatgtatatgtatagctatccggcagggattgcggat