Description :
From Genome Similarity Track
Location :
Scaffold_303:601- 1664
Transcript NameFunction/comments
Phyci_20145Hypothetical protein

Sequence
1063 bases(100 bases per row)
gcgtcggtcgacaagcacttacgtgggcagcagcagagcggagagggcaacgaggacaagccagaccttcattttttagggccgtgtgggagtcgcaact
tgaggcgggtggagtcgttttcggaaTGAGGTGCAGTCCCGAAGCTTCACTGAGTCAGTAGACAGTTTTGCTCGCAGTGGGGCCCCTAAGCTTACGTAGT
CCAACAACCCTTTTTGTCTGCTTGTGCTGTGTTGAGTCGGGCTCATCATATTTAAGTACTGTTTGAGACCCCCTGCTGAAGATGTTCAGAGGACTATGTT
ATGAACGTGTTTACGAACGTTATATGTATCACACAATACTGAGTCGACCTTGATCTACAGACTGTGCCTTcgtcccgtaagtcgtcccataatacgtatc
gtaaattaccacgtaatgataaattacgtgcaccacaataaactatgaaacttgtactacctccgttcggaaatagatCgtaacggggttacacgtacaa
gtggctgcaagccacatgtggatttaacagatagattatctgttaaaagttttggctacttcctcaccttggtgtaagtcacaccaatggatacattgaa
gtggaccaccacaatgagtggtccacacctacctaaagatcctattggtagaaagcagcatctttctaccaattagagacgtgcatattggcggggctct
gactgccagccgctgtcaaccctttcatagatgataaacagttttagcagatttaggaggaagatcaatttacaaacaatacagttctcatNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN