Description :
From Genome Similarity Track
Location :
Scaffold_125:60097- 63973
Transcript NameFunction/comments
Phyta_totarag4134hypothetical protein PHYSODRAFT_345489
Phyta_totarag4135hypothetical protein

Sequence
3876 bases(100 bases per row)
CGCCGAGTAGTCCAGCGTGTCAGCGTTCCACATACCCACGCCGCGCAGTCCGAGCTCGCGGACGAGTGCGTACTTGGCTTTCAGACTGCGCGGGTTGTCG
AACCAAATCTGCGACCGTCGCCCCTCCAGCGAGTACCACACGAACGGGGTCTGCGTCGTGGGGTCCCATTGCTCGACGAGCCCGTGGCTCTTCACCAGTC
GTCGGATGTCGCCGTAGTCGATCTGTCCACCGGCCGCGTCACTGCAAGGGGCACCGAAGAAGGGCACCGGTCGGATCTGACACCACGAGGCGTCGTCAAT
TGCTTCGCCTTGTTGCTCCAGGCACGGATAGCGGTAGCCGTACCACGGAACCCCGAGCACCAACTTGTCCGGCGCGACGTCGTACGCGAGCAGGAACTCC
TGCAGCCCTTGCTTCACAAGCGCCCACGGTGAGTtggcaccagcaacgcacgCGTCGTACACTTGACTACGCATGTCGTACGACATGACGAACAGAAAAT
ccgtggcggcggcgagctCGCGCCATGGATAGTAGCGGCCATCCACGCCGCGAGGGGCCCAGGGAACGTCAAACGTGATCTACAGGTCAAGCGTGACGGA
TGCTAGGAGTCAGCACACATAGTCGAGCGATCGAGCTCTAATTACCCATGCTGAGAACGAACCTGCGCGTTCTTCGTGAGTGcgtgctgctccagctcaa
gGCGCAGTTCGTGCACGAGCGACCCAAGACACCGCGACGTGGCCCCGTGCATGGGCTTCTCGGTGTCAATGTTGACCCCGTCAGCATAGTTCTCCATGAT
CTTAGAGTACGCCGCCTGGATATGCAAACAAAGTAATTGTAATACTTGGTAAATACCGTCTAACACGCCACCAGTTCGACGAACTTAGTCCGACAGATTG
CTCAGGTCGACGCCGTCATCTCTACCTTGATCCAGTCCTGGCGTGCTGTGCCATTGCACAATTGACCCACGTCGTCAAAGTTGTGCTTCACCACAACTTT
CACGCCCTTGCTGTGTGCGTGGCAGAGCAGTTGTTTGTCCTCGTTCCAGGCCACCGTCGTGAGCTGGCagttccaccaccaccctCCCTCAGTACCGCGA
CAaccaacgacagcagcggatCGGTTCAGCAGTGCGTACCTGGCCCCAGTCGTAGCGTTTCCAGCGGTCGTCCGTCGCCACGGAGAAGGCAAAGACCTCC
TTCCGAGGCTTCTTGCCGGCAAAGTCCACGGGGAGACATAACGACGCCGAGCTGAGctcgtcactgctgcttgggcaCGGGCAGTCGCGCAGACGAGCGC
GGTCCTCGTGAGTCAGGCGATCCACGAAGAGTCCCTTCGCGTCGTACACCGGGACAGCGCGAGAGAGCACCACCACTAGGGCGACCACTACAAGCAGTCG
CGACGATGGGGGAAGGCGCAACATGGTCCGCCTTGAAGCTGTACCACAGCCTCTCGTTCGCACTTCTGGTACAGCGTACCACCTGCGATCCTATTACGCA
GGGGGGCCAAAGATCGTGACCCTTCGTGAGCAATATATCTTTCGGTGGTCGAACCGTTGAAAAGCGAGCACGGCACTGCTAGATACACGTGTAGACCATG
GCTCGGACCAACAGCGCGCTCATGATGAGTATGGGCACCGTCAACATGTGGGGCTTCTCGCCTGCTTTCGACGTGTGCAGCGGCCTTCCGGAATGGGACA
AGGACAAGAGCCAGAGTTCTACTGCTACAGCCGGTTCGAGTGTCGAATACAACGAGGAGAAAATGTCTGCAGAGCCGATCAACGTGCTGTTGGCGGGGCC
TGGAGACGTACGCCACGTGCTGGCGACTATcgcacgtcgtcgccgatgGGAACCAGCATTGAAGCACCGGCCAGTGCACATCTACCTTTTCGAGAAGGCT
ATCGAGACGCTTTCGCGCGACCTGTTGCTGATCCAAGTTACACTCGATATGGATCTTCCCCTGCGTCAACGATGCAACATGTTTCTGGAGATTTTTGGCA
ATGCTCGGGTGCAAGTACGTCACTAGGAGGGTGCCACAACGTACGTATTGACTAACGTGTTGTTGCACTGGTGGTGTGATATGTGAAGGAGAGAACGAGT
GCGTACATCGAAGAACAGGCGAAATTGCTGACGGACTTCGTCTACAATGACCGTGGTCCATTGGCAGGCCTGGTAGACCTTTCGCATTTGAAGATGCGCA
CACATGACGACCTCATTGACGCGTTCAGAAGCTGGTTTCAGAGTGTCAACTTTGATGGTAAGGCAGTGAGAGAAATTTGACGAGGGGGTGATAGGGACTA
ATCTACCGTGTGTTTGCTCGTAGTTGACACACTTCGAGATCATCGGCTCCGGCACTACTACGAAGCTCGCTACGACTACCGTGACAACCTCATTGACTGG
GACTATACCGTAAGCCATGCAAACTGTTTCTTGGATTTCCTCAATACCTTGTACAATAATGCCTTTCTCTCTGTCTCTTTGCTCAACagatgaagctcaa
gaaaATTGAGAACGCCAGCGTGATTCATATTCGCCAGTATCGCGATTGGAGAAACTCTGGTGTGGCTTTTGAATTCGGCGACCAAACCTACACGGTACCA
AACCGCACCATGGCAGCATACACGGAGGTAAGATCGTTGGCGTTAGTTAGAATGTGAGCAAGATTGTGGGTCTGACAATTGTGCTGATGATCCGGATTCT
AAAATATGCAGGCAAAAAAGAAGCACCATGGATCCGTGCTGTGTAGAGGCTTGTGGACGGATATCATCGTGAGTCCATACATTTCGTTCGGTGTTCATTG
TGAGACACCCAACAAattcgtggagcagctcttcgagatTCACAACAAAGGCACGGGGGTTGAACAGAATCGCCACGTACGTATTTGTTGCGATTCGTCT
TGAAATCGGGTTCTTACTACATTGTTGTTTGCAACAGAACACAGGGGAAGTTTCCGTGTACAATGTGCTTTCGCATTTGTACGAGATCGAGAATGGCAAA
GTGTATCAGATGGAAAAGGTGCCGCATAACTGTCTGTTGCGTGCTCTCACCCATTCGTCCGCTTAAACTAACATCGTGGATCTTCGTACCAGGAGCACGA
TATTTTCAGTGGAATTGGCGACACAGAGGGGACACGTGTTGATACTGGCAATCAACTAGGAGAAGACAAACTAGTCGCGTGGTtcgaagagctggatgag
gaCAAGAACCAGGCAAGGGCGATCGAAGAGTAAATGCTACATTTCTCTTACTGGCACTGTAGCTGCTGATCTCACTCGTTGTTGTGTCCAGCGAAATGCT
TAAACAGCAAAAAACACACGATGAAGCTCAACAGCGTGCGAATACAATCAGGGAGTCTTTACAGGGCATAAAGGTGCAAGCTGCTATAGCTTTTGAGCAC
TCGTGTATTCAGATTCTACTAACATGATGATATTTACATTGCCATAACTGTAGATCATCCCGTTGACAGGGAACATGGAGGATTTGTTCTCGAAAAAGCG
CTACACGAACCTCTTTGACTACGCATTTATTTCATCCCAGCAGTGTCACACACTTCAACCCCCCAATGATgtggagcagcaagcaacaacagcgtTCACA
GACATTTTGAAGGGTGGTGCGACCGTAGACGTTGAGTCTTCTGTGTAAGTGCATCAAGTCAATCATATTTCTGCTTATGGTGTAAACAGGAGATTGTGAC
TGTGATTGGTCATACAGATTCATGCTACCTCTCAAGGAGGAGCAAAGAGCACTCTATGTGACGAAGCTACTGGAGTGGACAGCGCACCATTCACTGAAGC
CAACGTTTGATTTTGGCGGCAAGCAGGAACCTTCCAACGAAGACATGACCCAGATTAAGAATGCAGTGCTACGGTT