Description :
From Genome Similarity Track
Location :
contig_46:60097- 61494
Transcript NameFunction/comments
g8169.t1hypothetical protein

Sequence
1397 bases(100 bases per row)
GCTTACGGCCTCGAGCGCGATTGAGAAGCAGAAATGGATGGCGGAGCTCAATCAAGCAGGCGCGCTCGGAGATTTACAGCACTCGATCTCCATCAAAATG
CAGTCACCAAGGCCCAGTATCCCTACGCCACCGCCTGCCGAGTCGGCAGCACTGGCTGCGATCATCGATGCGTTTAAAGGCCGTCGTAGATCAACGCTAA
AAGAACGAAATCGCTCGTCCATTTTCGTGCCTAAGCCCGTGGACGACTCGCTTCACGTAGAATATCGCATCAGTTGATTGAGTTGATGAATCGCCGTACA
CATGGACTTTCGCATCTCATTCAATTCTCCTTTGGACAAGGGTGCGCTACTAAGTACTTCACATTGGCGCACTGGCAGCGCAAGCCGACCGCTTCCACTC
GTCTACTTGAGCTCCACAGTCGGGTACCACTGCTTGAGCGTGACAACCAGCTCCCGGAAGCTGTCGTCCACCACCTTGTTCACGAGGATGAGTCAAACAC
GCCCGGCTGCTGGCCAAAGGCCACTTCACCCGCGGCGTTCTTCACCCGCAGCTGGATCTTGTCCTCCGTCTCGGTGCGCGTCCACGGAGACGCTTCTCGA
GCTCGTCCATCGACGGCGGCGCGATGAAGAGGTACTTGGCACGGATGCCCGACTTCTTCACCTGCTGGACGCCCTGGATGTCAATGTCCAGGATGCAGAT
CTTGCCCTTCTCTTGCACGTCCTGCACGGCGCGCTTGCTGTGCCGTACACGTTGCCGTGCACCTCAGCGTGCTCCAGGAAGAGCCCGGCCTCGATCTCCT
TGAGCACCTTCTCCTTCTCGGTGAAGTGGTAAGCCACGCCGTTCACTTCGCCCTCACGCGGGCCACGCGTCGTATGGCTCACGGAGAAGCCAAAGGTGTC
GGGGAACTGCTCCAGCAGCAGGTTGATGAGCGTTCCCTTGCCGACGCCCGACGGTCCGGCGATCACGATGGGATCCAGCTGTGCGAAATTGTCACTATTA
AACGTCATTTTTGACAACCCCTCACGGAATGTTGGCCACGAACCTCCGCGTGCGGCGGCTTGAAGGCCGAAAAATGCTCGGCCGCAAAGGCCACGACGTC
CTGCGGCTTCTCGAGCAGCAGCGCCGACATGAAGCCGCTCAGCAGCGTCTTGATCTCCGGGTGCGCCTCCACGTAGGCGGCGTGGTCCTTCTTGAGCGCC
TCCTTGCGCTCATTGAGCAGAGAAAGCTCCTCGAACGAGAGCGACTCCAGCGCCTTGGTGGCCTCCTGCTCCGCGCCGCTCATGATGCTCGATTGGCAGG
GGAATTTGTGTCGTTTGCAGGTCGTGGAATTGCGATTCGGTCTTCAGATAGTGATATCAAATAAGGGGGGGACGAAGCGTTGAGCACAATTGCAATG