Description :
From Genome Similarity Track
Location :
Scaffold_44:60090- 61194
Transcript NameFunction/comments
Phypa_INRA-310PPTG_14969hypothetical protein

Sequence
1104 bases(100 bases per row)
ACACAGCAGTTGGTCATCGACTTGACGCACACCGCTCTGCGGATTCCGTGCCGTTCCGCACACACCCTGTGAGATTCGCTCAGGGCTAACAGCAACCTCA
TTGCTCACCACGGCCGCTTTGGCCTCATGCTCACGCCAAAAACACTTCCTCTTCCTAGCAGAGGCGAGCCCATGACTCTCCAATGCTCCACTAGGAGGGG
TGCGCAGCACCCAATGTCTTCGACTCCCAGTCAATCCATGGATCATGACGCTCCAGCCATGCCATGCCTAGGATGAGATCATATCTCGAATCAAAATCTA
TGACCAAACAGCGTTCCCCGCTATCGAAGTCTAAGAACTTTACACCAAGGTCTACAGAAGCTGTAACCAGTGTCCTCGTCGCAAGACGGACAGAGATCGT
GTCTCTCATTTGTACTTCCAGTGCCTCAGCATACTGCTGACCCTTTAAGGGAGGAACGGTGGGCATATTTGCCCGTGGCACCCGAGTCTATCAAGACTCT
TCCCAGCTTAATAAAGTCCTTCGCGTTTGCCTGAACGACCAGCAAGCCCGGCTTGCGCACACTCTTCAAGAGTCTCGCAAGAGAGCCCAGTTCTCTTTCG
GGGCTAAATCCCGTTGATCTCTACCTCCCGGAGGCTCAACATACCTCAGTTCTGCCCCAGTAGGCCGCCCCGCGCCTGCTGGGAGTCGCCATCTCCCCGC
GACGACCCGAAGATTGGCTCGACGATGCCTGGAGCTTGTTGCGGAGAGGGCAGCCTGCCTTCGATGCATAGTGATCATGCACAGAAAGCAATGGTGGATG
TCGGCACGCTGCTCAGTAGTAAGAAGCTCCGCTTCTTCGTCTTCAGCATAGCTGAAGGCCATCGGCTCCGGACCGCTCGAAGACTACTACTAGCGCTCCA
ATTAGGTAGATCCAACCTGAAGCTGTGTTCGGCATTCATGCCACATTCACATTCTCTACGGAAGAGGTAGGGTGTACACGGAATACTTCCGTTCGAGCCG
CACTCGTGCGGAGTCCCTCCATGAACACACTCACCGTGACCAGTTCCCGAAGAGGGTCCACCGCCATCCCGGCGATCAGAGCTCTCAACTCCTGGACATA
GTCC