Description :
From Genome Similarity Track
Location :
Scaffold_3:60081- 62438
Transcript NameFunction/comments
Phyin_T30-4PITG_02069Vacuolar sorting protein SNF8

Sequence
2357 bases(100 bases per row)
GCGAAACAATACTCGGATGTGGGTGAGCAGCTCGTGGAGGCAAATTTGTCGCACGTGTCGTCGCAGCTGGAGCTGTTCCGCACGAACCTACAGGCGTTCG
CTATCAAGTACAAGAACAACATCAAGAAGGACCCCGATTTTCGACAAAAGTTCCAGGCCATGTGCGCCAAGATTGGTGTTGACCCGCTGGCCTCTAAGAA
GGGATTCTGGTCTGAGCTGTTGGATGTGGGCGACTTTTACTACGAGCTGGCGGTGCAGATCATCGAAGTGTGTATCATCACGCGCCCCAAGAACGGCGGA
CTCATTGGCATGAGCGACCTACTGCGTCTGTTGGAAAAGAAACGAGGTGCAGCGATGCAGACGGTGTCTGACGATGACGTCAAGCGGGCAGTCAAGAAGC
TCAGTGTGCTCGGAGAGGGCTTCCAGCTGATTGACATGGAGGAGAGGACGATGGTGGGCGCTATAAAGAAGCTGCTTGAGACAGGAAAGTTAGGCTAATA
TTCTCTCTGTTGCTACTATAGATTGTGACTGTGCCGGTTGTTCTGAGTCAAGATCACTCGACGATCTTGGCGCTGGCACAGACGACATGCGGCATGGTGA
ACGTCAGCATTCTGGCACGAGAGTTGCAGTGGGACAAGAAACGAAGCATGCTAGCCCTGAACGTTCTGCTTCGAGAAGGCATGACGTGGCTGGACGAGCA
GGTGCAGTTGTTCTTGAGATCTTCTGTGCATTTTGGGTTGTATCTGACAGTGGCTGAGTTGTGCTGCGTAGACGAGTGAACCTTCCTACTTTTTCCCTAG
TATCACACTGTCTGGTACTTACACATAGTTGTCTAGAGCTACACCAGCTTGACGAGGTGGAAAAACTGTGCAGATAAATAAAGTTAAAGTGATTTTCTGT
AATGAGACGGCGGTTTTAATGCAGCAGTCTGGATCGTACTTAGGAGAAGATGCATCTTCACTCGCCCGTGGCGTCTGCAACGGACAGTTGTTTTCTTGAT
AACTTTTCAAGCGTTGGCGTTGACAGAATCGACGGGCTACTAGCGAATCAACTTCGTGTTTGGACTAACGTTGCAGTATTTTGCCTCAATAAGAAAGTCC
TGATTTACATAAAATTGTCACGGTACTGTCGTAATAGAGGTTTAAAATTTTGCTTTTGTTAAAACTGAGATGATACAGTTTCAAAGGCTATTAGGCTTTG
TGTTTTGAGGCAAAATAATGTACTTCTACATTTGAAATTTTTCGTCCGCGGCAACACCGCCGGCTACCCAAGATGACCGGAAGTACCCCGCCATCAGGTA
CGAATGGATTTGTCTGGTGTGTATGGTCGACGTCGTCGACGTCGCTCTCATCAGATGACGGAGTGCAGCAGGACGCTAGAGAAGAGCAGCGCGTGCAGCA
GCAGGGTACCCCAATAGAACAGCAACGCGCGCAGGAGCAGGACTCTATAGAAGGGCAACGCGTGCAGCAGCAGGGTACCGCCGCCGATGCCGAAGCGAGT
CGCTTCAAGCAATTGCAACTGAAAAAATATAGCTGCAACTTCAGGAAATGCTTGGAGAGACAAGACAAGACGTCGTCACTGCTGACCAGAAGCTGGCGTC
CAGAATCGACACTGCCGTGAAGATGGTTGTTGCGGATCGGGTGCTCGAGTTTACCGAGCTTCGGGAGCAAGTGAAACAAGGTCTCGTGGACATGACAGCG
CTTCGCAAATTGGCCATAAAAGACGTCGACTACACGCAAGAGCTTCGCAACGAGACCAGACAAACCGTTCATATTAAGAACAACCCGATACTAACAGCGA
ACGTCTACTACTCGTTCACTTGCAGAGGTCGTGACGATGTCTGGGCAGTGAGCACGACGGAAGAAGTAAGCGTTAACACACTACTCGCCCCACACTTGGC
AGATTGGGAATTGCTGGAGCTCCACCCTTGGTGGACTCCGTTAGAAATAAAAATGTCAACCAAGTATCTAACGGGCGAATGACTACCAATACTAAAAAAG
ACTTCTGGTTTCTGAGACTGTGTCGTCCAGGTCTCATACTCCCCTGAAACTCGAAGTCTTCCTTAGCTTGTTTTAGCGTCATCTGGGTCGGATTGTTGTT
CTGGTTCTTCATCTGTATCCCCATCAACTTGAGTACACAGGCATTCGACACCACGCTGCTTTCGATGTTGGCGAAACTTGCTCTTACCCAATGGCTTGGT
TAAGGCATCAGCAGGCATGACCTTAGACGGCATGTGTTTTACCACAATGTAGCCAGCATCGACATAGTCAATAACCTTGTATATCATCAGGTCTAGACAC
TTGATCTTGGGATGTCCACTGGAATGCGTCATGACCTGAACAGCTGCAGCATTGTCC