Description :
From Genome Similarity Track
Location :
Scaffold_1563:6007- 8584
Transcript NameFunction/comments
Phyta_totarag13262hypothetical protein PHYSODRAFT_321326
Phyta_totarag13263hypothetical protein

Sequence
2577 bases(100 bases per row)
CTCCGGGTAGGAAGTCAAGGCCACCATGACATCGGATCGCTGGGACTCATCGACTTGACGAAGCCTTGAGATTGCTGGAGTACGTTGTTGATGCAGTTCA
CACGTATTACCGAATAGATCCGCTTGCTTGTTGCTAACAGGATCCTTCGACTTTTTTTTTCCACAAATGCATAGATGAATGACGTCGAACACTCGGCTCG
TACCGGATTCAAAACCGACAAGCGTTCTAGTTTAACATCTACTCAGCAGACTCAGGTAACATACCCGCATGCTTGTTCGGATTGTACCACTGACGGATCA
TGTTGTAGAACTCTTCCATCGGGCACTTGCCCACGCCATGGAGTTCACCACATTCGCGGCAGACAAACAGACAGCGATCTGACGGGTGCCCTTGTTTTCC
GCACTTCTGACAGGTCaggcgtctccagcagccaagaTCCGTGTGGCGTACGGATCCGCAGTGCGAGCAGCGAGTGCGTCCCGAGCCACCGTGTCCGGTC
GGCGATCGGCGCCCCTGAGGGGCCAGGGCCTCTACGATCCGGTCATGCTGGCGGCCGTCATGGTTCCTCGCTTCGTCTGTAGGCGGCTGGTCTGGATTGG
CGGCAGCACTTGGCGCAGATCACCATCGGATTCTTCCGATCCACGGTCTTCAGACTCCGATCCTGAGTCAGGACCCGGGACCTGAATAGCTCGTACAGCA
CGTGCAGGCGTCACTGGCTGAGTCGGCGCTGCCTTCTGCCGGTACTTGTTGGATCCCGACACGCGTTTCTTCTGTCGGCTCCTGGCAAGCTCACGCGCAC
GCAGGACATCCTCAAGCTTGTAGGCGTCTTCGAGGCGTAGCAGCGTGAGCTGATCGGCTAGATCCTGATCGTCCAATGTCTCAATAAAGTGATCCACTTG
TTCACGTCGATCCTTCGGCTCGCCATCCTTGATCTTCAAGCGGCGACTCATCCGTGTGTTTGCGCGCGTGGTATTACTTCCACGCGACTGAAACCCGCTG
CCCGCAGTACTGTGTCTGAAAGCTCCGCAGCAAGTCGCTCCACTTGTTGCGTTTCGTACGACTCAGTTGGCGATGCCAGTTCTTCGCTGATCCTGTGAGA
AGATCGGCGAAGACCAGACATTTCTCTTCATCCGAGGCTTGGGCGCGCTGGAACGTCTACTTAACCTTGCTGAGCCAagctcgctcttcatcatgATTCT
TGCCCGTGAACTCCTTCAAGTCGGAGGTTGCTGAAATCCGGACTCGCTGGATCATGGAGGATCCGACCGATCCAGCTGTCGCTGTTGCTACGACCGCACG
TCGGGTGTCCAAGACTTCAAGGTCATCAGGATCATACTCCAAGTGCTGAAGGTCCGGGGTCTCGACCGATTCCATCTCGACGTCTTGGGAGCCGGGCGAT
CTCGCCCGAGTGACGACTCGTGGGGTGGCTGATGCCTGTTGCTCACGCAGGAACCGGCTCATGGCAGACTGGAAGTACGCCTCCATTCTGTCTGTCGGCT
CGTGCTTTGGATCCGTGACTGCGGATCGAGCGACTGCAATACGTGGTTTCTCTGGATCTGTGATCGGGAGGGCTGTGCGCGATCGCAGCATCGCTTCGCG
CGAAGGGCCAAGCGACatgcgctgcagactgctggagctgtccgAGTCCACCTCCGACGTCGCTGAGGCGTAGTGGGGGGATCCAGTCTGTTACTCCGGG
GTGCGGATCTGGGGAGACGGCTGACGATCTTCCGTGCGAGGTGTCTCGCCCACAAGGGTCTTCAGCTTCCCGAAGAGACCCACAACGGCGGTCTTCATCA
CGTCCAAGTTGAAAAGGTCGTTCGCGTCGAATGCCCCAGCAACGATGCCAGCTTTCTtcagcaagcgcagcaagatCTTCACTGCGGTCAGCttactcgt
cgtcgccggtGGAGCGGTTACGGGTCCCTTCAGATCCccaagcagctgcaactgcaagatcTTCACCACAGGGTCGTGATCCAAGAACCTGTTCAGCTCC
TTCCGGTGGTAGACGTCCTCCAGTTGGGCTTCGATCCAAGTAAGCTTCAATTCATCACGGTCTTCACCTTCCGACTCTGGAGCCTTAAGTTTCTTCCGCG
CGGCCTTGCTcttcgtgttcttcttccttgacGCAGTCTTGGAAGCCAGCGGAGTGATGGTGGATGAAGGCCCTTCAGTTTTCACTGACGGATCTTCATC
CGGCGGATCTCGATTCGTATCAAGATCAGCGGAGGTCCCCGGAGAGACCTGGGGAGGAGGTTGAGGTTTTGCTTTGAGATCCGGATCCGGATCTCCCTCT
CTTCCGTCGACAGAACTCCCCCCAGGGCTCTGTCTATCCGTGGATCTAACTTtctgcgacgtcgtcgcggaTCCAAATTCCGTCGACGCCTCATCTCCCG
ATTCCTTGCTCGCTAGCACATCTTCTTGGGACTCACGGTGAAATCCCGCGTCGCGAAGAGATCCGGGCACGCGAACCATTGTGGCGGAGCGGGATCAGAA
AAAATCTGTCCTCACACGCACACGTGTGCCCAGACgccgactaacggagggggtactccgNGGGCTTGGATCCGGCG