Description :
From Genome Similarity Track
Location :
Scaffold_124:6006- 8413
Sequence
2407 bases(100 bases per row)
CAATTTTGGGAGTCGCTTCAGGCAAATCCTTTGTATAAGGATTTGATCGAATTCAAGGACGTGTTCCCTGAATCCGTACCATGCGAATTGCCTAAGGATA
AAGGCACGACATGAAATCGAGCTCAAACCGGGCTGAAGTACTGTGTCATGAAGCAGTGTCCATTGCCTCGTGAACAAGTACTTGCGATCGACAAGTTCTT
TGCCAATCGCTTAGCTGCGGATCATGTGAGGGAGTCAACTTCCCCTCACAGCTCTCCAACCTATTGTGTACGTAAGGCCACATGAGGATGGCGGATAGTG
CACGCATTCGACAAGTTGAATGCTGCAACGATACCGGCTCGGACGCCGATACCGAGGAAAGACGTAATCATTGATGGTATGTGAAAGAGTACCATCTTTT
CGTCCATGGATCTGATGGATGGCTTCTATCAGATCCTAACGCGTGAACGGGACATCCCGTACACGGCAGTAAGCACCCCGAGCGGTATGCTCTGGGAGTG
GCTAGTAATGCCACAAGGGCTTAGCAACGCCCCTGCCGCATTCAAGAGATGTGTTACGAATCTGTTGAGACTGGTGCGAGACTTCGCACCGACTTACTTC
GACGATGTATTCGTCCATGGCTGGACTATGGGTGGAAAGACGGACGCAGAGGTTCATAGAACACACGTTCGTCAGGTTTTTACACTTATGCGCAAGCATA
AGCTGTATGCCGCCAACCTCAAGAAGTGTAAATTCGCTGCTAGCGAAATACCACTTCTTGGGTGCATCGAACACGGCGTACGCCCTGATCCAGGAAAGAA
CAAGGCGATTACCGACTGGCCTGTGCCAGTCGACGTTAAGGGACTTAGAAAACTCCTTGTCTAGCGGCGTACTTACACAAATACTCGCGCAACTACGCCG
AGATGACCATTCACCTCTCTCGTCGCTTGAAAAAGCACGCGAAGTGGTCATGGGACGCTAATTGTCAGCGTTCCTTTGAAGGTATCAAGCAGAGCTCGAT
GTAATCGTCCATCCTGGTGATTGCAGACCAAAACAGACCATTCCATGCGGTCTGTGACGACAGCGATTTCGCAATCGGCTGCGCGTTAATGCAGGTTGAT
GCAGACGGCGCAGAGTGCGTCGTCTGTTATCAATCGCGTCATCTGCAAGCACATGAGCGTAATTATCCAGTGCGTGCAAGAAACGCCTTGCCATGAAGTA
TGCACTAGCAAAGTTTCGCGTCTATATTCTTGGAGATAGGCCGTTTGTAGTCCATACGGACCATGCGTCATTACGCCCAGCCGTAAAAAGCCCACGCCTA
TCGTAAAGGATGGCGAGGTGGATGTCCTTCTTTGCGGAGTACAACTTCTCCGTGGAGTACAAACCCGGACGACTTAATGTCGTCGAGGACGCGTTGTCAC
GCCGACCCGATTTTGAGTCGGCTGCGCAGTCCAACAGTGAGGTTAATACCACTGTTGCAACACTATTCACTAGTGTCCCGTCGTCAACATTGCTTGACGA
CATAAAAAGGCCACGCAGAAGATAAGGCTGTTCTGCGACTAATGAATCAGCTGGTGACTCCATCTCGCAAATCTCTCAAGGATTTACCTGCCTTGTATCG
ATCTTCCGCGGATCGATACACAACACGCAACGGGTTGTTGTATTATACAGCCGTTGCCGGTGACACCTCGTGTCGTCGTCCTCACTCATAATGATTTGCG
CTTACGCATCATGTATGAATGCCACGATGCACCAACTAGTGGGCATCGCGGGCGTGAGAAGACTTATCTCACGGTAAGTCGCGATTTTTACTGGCCCCGC
AAGTATCAGTTCGTGCGCGAGTGCATTCGTGCTTGTGAAGTGTGCCAACGGGTGACGCCCAGTCCTTCATCCCGTGCGCCACTACAGCCTCTACCGATCA
CAGCGGAGTGCTGGCAGTTCGTTTTAATGGACTTCGTCTTCGGTTTCCCCAAATATGCTCACCAGAATAATGGTATTCTTGTGTTCGTAGAACGATTCAG
CAAGATGGTACATCTTGCTGCAGTTCATGAGTCAATACCAGCACATGGTTGTGCCCGTGTCTTCATTGAAACGGTTTTCCGACTCCACGGTCTACCCCGT
GAACTAGTATCTGATAGGGATCTCGGTTCACGGCGGCGTTTGGCTATCTGTGTTCCGATATCTCGGAACACGTCTGACTATGTCTACTACTGAACATCCC
GACACTAATGGTCAGACAGAACGCGTAAACCGCGTCCTCGAAGAGATACTTCGAGGATACGTCCAATCTTTCACAGATTGGAGCGAATTTTTGCCGATGG
TGGATTTGCAATCAACAACAACGCATATACCTTTCTTCGTGAACGGCTTACGCCATCCACGCCTACCCACCCATTTGAGTGTGACACTAATTCAAGGGGG
GAGGGAT