Description :
From Genome Similarity Track
Location :
contig_14:600507- 601542
Transcript NameFunction/comments
g3791.t1hypothetical protein
g3792.t1hypothetical protein

Sequence
1035 bases(100 bases per row)
CTGCTGGAGCAAGTGGAACGGCGTTGCGCTGAGTTGCTCACCAAGAACGTCATGCTCACTGAGGACAACGAAAACCTTCGCCAGCATCTGACCAAGGCGC
ACATGAAGCCTTCACGCAACTGACAAAATGATACCGAATGCAGCCACACTAACTTCCGGTGCTGTTTGACTTCGCTGGTACGCTGCAAAACTAACGTGCT
GATTAGAAAGCTTAGATGCCTGGATAACCAGCGAATGTACGAAAAACGAATGCGCCAACCATCACTAAATACTTACAGGTGGTCCGAAGCGGCGCTATAG
CTCTGCTACCTTCGAGTGGTAGCTGTGTTTCAACGCGGAACGTTGGGTATATGTCTTGGAAATACGCTGTCAGCGTGGTGCCGACGTCTACGGATGAATG
TTGTTGCTCCGTAGCTGGAACGAGTCGTACTGTCGAGTGCCCCAAGCGTTGTAGCTCTTGCGCAGCAAGTGATCCACGCGATGGCGAATATCTTGTCTGG
AAAGCCCCACGAACAATCGCGAGCGCAGGTCAATGATGACGCGCGCCAGCTTCGCCCCGTGGAAGCAAGGGAACGGGGAGTGCTGGCCTGTGGTTTGGAG
CAGCGCCGCAATCTCGGACTGGTACTTCTGAAGAACCAAAAAGCCTTCACACAGACAGTGACGGAAGCGCTTGTAGCCAGGAGAGCCAAGACCACCCATC
ACATCGACCATCTCCTTCGTCAACTTGAACGGGGCGTCTTCGACGCTGAACATGCCACCAGGTGCGATACCGAGGATGAAGCCGAAATCGATGTGAATCA
CGCGGCCTTCAGCACTCAGCAAAATGTTGCCATTGTGGCGATCCTTGAGCAGCAGCACGTAGCTGACGATCGAGTACGCTGCCATACTCTCGATGAAGCG
GCGTTGAGCCGCGATGAACTCGGAGCTAGAGGGCTCGCCGTAAATGCTGCGGAAGTACTCGAACAGATTGCCGCCCGGGAATGTCTTCTTGAGGTGGTCC
AGCGAGCAGGCGTCGGTAATCGTCTCAAGAAGACC