Description :
From Genome Similarity Track
Location :
Scaffold_884:6005- 7205
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_884-snap-gene-0.10Cell division cycle 6

Sequence
1200 bases(100 bases per row)
GGCAGTTGCCGCAGCAGCTCGTCGTCCTGGAAGGCCTTGGCCAGCGCCTCCATCGCCACGGTCGACGTGAGCGTCGCGAGCCACATGCGCTTGGCCTTGC
TGGTCGTCTTGGTCTGCTTGACGAGCGCATAGCACTCGAGCGAGCCGATATGCTGCTGGGCATCCTCTAGGCGGAACTTGGGCAACCACGCGAGCGACGC
ATGCGTGGCCTGGAGCGACTCGAGCTCGTCGCACGCATCGCGCAGTGTCACAGCCGCCGTCTCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNGCGAGCCGCGTGAGCGCGTAGAGCAACAGCTTGGGCGCACGCGGTAGCTGCTCGATCTGCTTGGCCACCGAGAGCTGCGTCGCGATCGCCGCAGT
CGTGCACTTGAGCACGTCACGCACCGAGAGACGCACTTTTTTGGGCTCGGTCTTGTCATCGCCGGCCAGTGAGGTGAGGAGGCTCGAGCGTGCGCACTGT
CTCAGCATCCCGACGGCGCGGCGTGCGTCGCCATCACGGGCCGCGACCTTGCGCGCAATGAGCTCGAGCGCGCGCGGCTCGACGACGTCGGCGACTGGTA
TGGCGTCGGCCGTGGCCATCTGCACGTACGCCGTGAGGATGGCCGTGAGCTCGTCGAGTGAGTAGGACGGGAAGAGCACGACGCTCGTCGGGTGCGGGTC
CTGCGCGAGAAAGGCGGCAATCTGCGCGTGCATGTCGACGCCGTTGAGAATGCCAATGACGCGCAGCGCGGCGTTCGGCAAGTAGGCCCAGCGCACGAGG
AAGGCGAGCAGTTGCTGGGCTTTGGTCTTGAGCGCGGCCGACGGCAGGCGCACGAGGTGGTCCACTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAGCACGAGCACGCAGTCCTGTTGCTCGGCAGTCTGAGACGAC
GAGCGGTGGAGAGACGACGTGAGGAACGCGTCGAGCTGCTGCGCGTGGTNNNNNNNNNNGGGCGACGCGAACGTGCTGCAGTTGAGGCGCACGACCTGCG
AGTCCGCGCGCGAGTGGAGCGCCGCGACGTGGGCCACGCACGACGACTTGCCCGTGCCCGGCGGGCCGATCACAAACAGCGCACGCGTCAGCGCGGCGGC