Description :
From Genome Similarity Track
Location :
contig_14:600474- 601509
Transcript NameFunction/comments
g3609.t1hypothetical protein
g3610.t1hypothetical protein

Sequence
1035 bases(100 bases per row)
CGACAGTTAGAGGATGCTGCACCAGCTCGAGACAACGGGAGTGGAGTCCGTGCCATCACTGAAATGCACGCAGCACTGACGCGTCAGCTTGAAGAAGTGC
GGAGACTCACCCTACACCAGCAGCAAAACCAGCAAATGGCACGAGCTACCGACACTACAGCGCCACAAGCGCGTGCCATCACCCCAGCTGACCCCAAGGA
ATTGGAGACACTGCGGGCAGCCAAAACTCAACTGGAATCGCAGTTGTCGAGCAACAAAGCTCACTGGATGGCGCTGCTGGAGCAAGTGGAACGGCGTTGC
GCTGAGTTGCTCACCAAGAACGTCATGCTCACTGAGGACAACGAAAACCTTCGCCAGCATCTGACCAAGGCGCACATGAAGCCTTCGCGCAACTGACAAA
ATGATACCGAATGCAGCCACACTAACTTCCGGTGCTGTTTGACTTCGCTGGTACGCTGCAAAACTAACGTGCTGATTAGAAAGCTTAGATGCCTGGATAA
CCAGCGAATGTACGAAAAACGAATGCGCCAACCATCACTAAATACTTACAGGTGGTCCGAAGCGGCGCTATAGCTCTGCTACCTTCGAGTGGTAGCTGTG
TTTCAACGCGGAACGTTGGGTATATGTCTTGGAAATACGCTGTCAGCGTGGTGCCGACGTCTACGGATGAATGTTGTTGCTCCGTAGCTGGAACGAGTCG
TACTGTCGAGTGCCCCAAGCGTTGTAGCTCTTGCGCAGCAAGTGATCCACGCGATGGCGAATATCTTGTCTGGAAAGCCCCACGAACAATCGCGAGCGCA
GGTCAATGATGACGCGCGCCAGCTTCGCCCCGTGGAAGCAAGGGAACGGGGAGTGCTGGCCTGTGGTTTGGAGCAGCGCCGCAATCTCGGACTGGTACTT
CTGAAGAACCAAAAAGCCTTCACACAGACAGTGACGGAAGCGCTTGTAGCCAGGAGAGCCAAGACCACCCATCACATCGACCATCTCCTTCGTCAACTTG
AACGGGGCGTCTTCGACGCTGAACATGCCACCAGG