Description :
From Genome Similarity Track
Location :
Scaffold_109:60046- 61259
Transcript NameFunction/comments
Physo_158476hypothetical protein

Sequence
1213 bases(100 bases per row)
TAGCTCCGCTTTGCAAAGCAGCTTCCAGCAGCATTTTTTTCCTTTAGCTAAATACTATTTTTTCTTCCTAAAATTGACAACAAAATACAAGTTGAAGTTG
AAGTGAGACCATCACTCTGCATCGATTCCGCACTCCACGCATCACTTCGCGTGGCGAGATGAACTGGCAGCAGAATGTGGCGCTGCAGCACCCCGTTGGG
GCCACGGAGCGGCGTGAAGAGAGGCTGTACGCGGCTCCGAACGACAGCTCGGGGGATAGCAACATCCTCCGGTACATCAAGACGCTGACGAGCCACCAGA
CGAATGCGAAGCAGCAGCGAATGGATAGGTATCTCCGGCAAGTCAAGCGCCCTCAACCAGCTGAACAGAGTTCCACAACAGGCCAGAAGACACTGCCAGC
ACCTGGATACAAGCCTCAGGCCGCCGCAAAGCCCCTGGTGTCAACAGCAGCTCCAACACCCCGCCTACAGGAGAAGAACGGGCCCCGAGAGAGCGCCAAG
CCGCCAAAACGCGAGCCAAAAGCTCGAAATGGTCGCAACAGTCAGGGGAAAGCTGCTGGTGGCAGGGGCAAAGGCCGCTCTCGAGCGAAGCGCCAAAGTG
ACGGAGCTCCGAGTGGTCGGCAGCGGAAGAAGGTGAAGAAAAAGCCAATCTGCCAGCAGAGCACTGCGGTAGGATCGTTGGATCGATTCCGACTCAATGG
CACGTGGTCTCAAGACAAAACACGGGCAGCAGTGACTGCTAAACTCGGTGAAATCGCGGGGCCACGACTTGATACAGTCCAGAGTGACGAAAGCAAGCAG
GCTCCCCGAATTCAAGCCTCGACGTGTAATGCGGACACGTCAGGAAGTATGAAATCCCGGTTCTGGCCCAGTGCTGCCACTTCTGGCCATGCCAGCCAGG
TTAGAAACCCAGGTCTCTGCAGTCAACCGATCGAAGCTAACGATAGTGACGTGTTTTGTGTTCGGAGCAGGCTTCTCTCGGTTCATTCGGATCCACAAAG
CGTGAAGATCTACCACACTCGGGTCCACTGAGCAGCCTACCGCTCACCGAACGACAACAAGAGAGTATCATCGAAGCTCCTACTCACGAAGTCCTCGTCA
CCGCATACAACCCGCTCTGCGCCATCATGGAGTCCATTTACTTTTGATCACCATTGGAAAGATGACTCGCTCCGGCTAGTAGCAGCCATCGGTAGCACTG
ATATGTTTTATCG