Description :
From Genome Similarity Track
Location :
Scaffold_71:60045- 62608
Transcript NameFunction/comments
Phyra_82370predicted protein

Sequence
2563 bases(100 bases per row)
GCGTTCACTGTTGTCTTGGGACCCCAGCCTGCTTCCTTCAGGAGACTCTTGTTCCTGAACGCCAGTCGCTTCACAAACTCAGTCTGGGAGCTTCTCGGTA
CTAAGGTTTTCAGAGCTCCGCGAGTTCGCTGCAGCGCCACGAACACGATTGAACTGGTCAGCGTTGGGTGTGAGGATGGCGGCATGAACGGAGGAATGGC
CGCAGTAACACGATCTTCTCCGAGACGGAGAGCTTCTTGAAGTGCTGCGACAACAGTTGACCTCACCTCCTGACGAGTCTTTGACGTGATCAGCATCTGG
AACGAAGCACGGGCGGCGGTTGCAGCGTCTTCATCTTGTGTGGCTGTCCGTCCAATGGAGAGCAGCCCGCTCTCGGACGCACATCGATCGACCAGCACAT
CAGCTCGTGGAGTTACAAGTTGGGCCATGACGTGCTCACACACGTCTGTCGTCACGTTTCCCACAACAAATTCCACTACCGCCTTCAGCTTCGGATGCAC
CTTGAAAACCGCCTCGGAAAGCTTGTCGTTTTCTTCCTGGAGCGGCGATAAAGTGCCGGGGAACGCCGTTGTCGGTGACTTCACTCCGGAAGTGGCTGAG
TACCCATCGTTGTCATGCTTTGAAGTGAAAGACGAGATACCACCGTTCTGGTCATCCTGGATCACCACCTGCAAGGGTCGGAGTTTGCGGATGGGTGTGA
CCAGCTGGCCTTTAGTTATTCGTCCGGTGCCAGTCGAGAGTTTCCTGCGTGGTAATGGCTGCGCACGAGTCTGAATGAACCCACGCAAGTCTTCCAGCTC
GCTCACGCAGCTCTGGACAAACACTTGGCTGTACAGGAATGGCAGGTGGTCTTCTCCTTCTCCATCCTCTGACGAGACTCCACCCTCCTTTGTGAGCGCC
AAACGCACGTTAGACGGCGGAAGGAGTTCTTCAGACAGATAGTCGCCGTTATGTATGAAGCCAGCGTCCAGCTTCATTACGTGGAAGATGCGCTCGATTT
GCATCGCAATGTAGAGTCCTGTCTCGCCCAGGGAGTTCAATCGCGGCGACCGATACAGGAGCTGCAGCAACACCACAAGTTGCTTGAAGTAGGTCGTTCC
TGAAGACAGTTTATCCAGCGAAAGCATCGTCAGATAGTCACACAGCCACGGGATGCACTTGGAGATGGATGCCTGGAGGATGCTGTTCTCCAGCAACTTC
TTAACGTCGAGACTGGAGTCGCGCGCCACCTCTAGTGTGCTGATTCCTTCACGCTCGACAGCCTTGAACGCAGCATTTTGCTCAGATAGCTGGCGAATCG
AAGACGTGACTTCCCATTGCGGCGAGAAGCGCAGATATCCGAGGAATTTTGCCATCACCTTGAGTCTTAACACCAGTTCTGTGAAGTTGTTCCGAGCATC
AGCAGAGGGGGAGGTGTTTTCTCGAATGGCGTAGAATTGCCGCTCTAACTGGTGTTTGACAAGCTCGGAGAACTCGTAGCTATCACAGCTGTGCAGGAAG
TGAAAGAAGAAGAGCTGGTTGTCCGTAAAAAAACTCTTCATCCGATCAAGCGTTGCCGTGAACTTTTTGGTTGCGTCGTCTTCGTTGGTGGTAACTCTCG
TGTCCTGCCGGGGTTTCCATGGCGAATTGTTGTTTCCCTTGGCGCCAGTCCTGTTGTTGCTATTGCCTGAGCCGTTCGAGCCGGCGTTGTCACTACTGGT
ACGCAGCTGCGGCTGCGGTGACTTATTCAAAGGCTTTTGGTTTGAAAAGCGCCGATGCAGCTTGCGCAAACGGTCCGGGTTCTTCACCACGAGTTTATCC
TCCATGATCTTCAGCACAAGTTCCTTATCGCTTTCACCGAAGGGGTTGGAACCCACTTGCAGTAATTCCTGGACGAAGAATTTGGCGAACCACCACCTGT
TCTCAGGAAAGACCTCAGCTAGCAACTCCCGCGCAAGCGCAATAGCTGCTGCTGCCACACCTGCATTCTCGATGCCGACGAGACTGTGCTGCTTCTGCTG
GAATTGACGCAGTAAGCTGAGAAAGCCGTCCCGGACCTTCTCGCGGTTTGTGTACAGGAGGGATTCCGCCGGCGTCCGGTAGTGCAGGCGCGAGTCGGTC
TCTTCGTTGAAAGGGAGTGCGAAGTCTCGCACGGCACTTGCTTTCATCTCAACTGGCAGCTGACAGCCGACTCGAGCACTTTCAGCCACTCGGAGCTCCT
CGCGCTGGCGAGACACTTGGTCAAGTCGCTCCAACATGGACGAGCAGATGCCCTCGGCGTCGTGCAGGCTGTGCTCGACTAACTTGAGCAGGTCCGAGCC
AAGATGTGTCAGCACCGGCTCAATCTCATGAAACACGATCTCTGCGAAGTCGAGACAGTGGTCACGCCAGCAAAACTCCGACGGAGCTTCGCAGTTGTTA
CCACCATCACTCCCCGGCTGCTCCTCATTGCTGCTGCAAGCCGTGCAATTGGCCCGATACAGCAGACTAATGAGCACCTGCAGCTCGGCGCACGTACTGC
TCACAAACCGCTCTCTGATCAAAAACCCGTACAGCCTCGCCGCTTGTCGGTTCACCTTGAAGT