Description :
From Genome Similarity Track
Location :
scaffold_12:60045- 62160
Sequence
2115 bases(100 bases per row)
GACGTCCTTAGTGCTAACCCGCTCTCTGGTCTTTCAGTCGAGCATGGGTTCGAGACGATTGATCGTGAACCTGGTCCAAAGcatgcagttcttcgtcagc
GGCCTTTGGTGCGTGAGCAAAGTGAGTATATCGTTACGTTCTTCGCtcaaaagcaagctgctggtttggtgaaggaaagaAAATCCCCTCACAGCGCGCC
GACGCGTTGCGTGCGCATACCAAATGGTAAAtaacgtatcgttcacgcttataacaAGCATAATGCGCAGACGATTCCCGCTCAAACTTCGATTCCGCGC
AAAGATGTCATTATCCATCGTATGTCCGGCTGAACACAGCTAATTGTATTTGATTTTgttgatggatattaccaaatcTCGATGAGGGGGGAGGACGTCG
CTTTGACGGCATCGGTATATGTTATtggagtggcttgtgataACACAAGGACTATTCAATGCCCCAGCAGCGTTCAATCGATGGGTCGCCATCTATTTCA
ACCACAGCGATGCTTTGCACAAACCCAATTTTACGGTATTTTTGTCTATTCGAAGGACGAAGATGGCAGATCTGCAAGAGAAATCACTTGGAGCACCTAC
GTGCGGTGCAAGAATATATGCGCGAATATCCAAGCGAACCTTGCAAAGTGAATCTTCGGCGCTAACGAAAAAAGGTCCTCGGCTGTTATGCTGGTGAGCA
CGGTGCTCGTGCAGACCCTGAGAAGGTAAAATCAATCGTGGAGCGGCCAATGCCGAGGAATCATATAATATTTGAGGAAATGGATTCGTTTCTCCAATCA
CCTGCATCGTTTCTTGCGTAACGACGCAGAATCGGTACGCCACTATCAAACTGGCTGAAGAAGGAAGTACCATGGGAGTGGTCGTTcacttgtgaagaag
cattCACTCAGATCAGAAaaagattgattggaggcaTTTTTCTTGCTCTACCAAATGCTACGAAGCCGTAAAACGTGGTGTCTGACGCttctgagtttgc
aaaaGGACTTAGAAGAACACGGTCGTGTCATGTCGTTTCACGACAGCTGAATCCAGCAGAAAGAGAACTAACAATGGAATTAATAGTATTCAGGCAAAGT
TTCGTGTTCACCTATTGCTTAGACTCCGTTTGTCGTCTACATGAATTTCGCAAGCTTGCGATATGCAGCTTAGTCTTCTCATTTGTCACAGCGGATGGCT
CGCTTGTTGTCATTCTTCTCAGAATGCATTTTCACGGCCGTATAAACTGGAAATGAACGTGCTGGCTGACACTTTGTCAAGTCGTCCGGATTATGAGTAG
GCCTTAATAGCTATTAAAAACGATGTATTCCATATGATACTTCGAGCAAATGTTGATAATCAATTGTGTGATCAAGACTCATCGAGTGATATGGAACTTC
ATGACAAGCTCCCTGGTCGTTTGAAATTACGGATGCATTGTGATGCATTAAAAGATGGTCTTCTTCACTATACAGTTGCAAATGGCGACAAGCTACGGAT
TGTGGCTCCCCACAACGATGGTTTGAAACATAAGATCGGGGCGGCAAAAGTTGAGCACTGAAAGATTAAAAAAAGACCTTTCAAACTTTCAGTGCTCAAC
TTTGGCCGCCCCGCATGAAAAAGTGGGTTGCAcgatacgtgaagacatCCGATGTAAAAAGCGCCCGGCACACGCAAGTGCTGCTGCAGAGTCTCTCTGT
TCCTATTGATTGCTTGAAGTCAGTCACTCTCGACATTATTCTTGACTTCCCCAAAAAGGCCGATGGCCATGATAGTGCTCGTCATTTTCGACAGACTCAG
GAAGATAGTTTGCATCGCTCCATGTAGCGACTTCATCGTTGCCGAAGGCTCGGCTGGACTGTTCATTGATCATGTTTTTTGCAATCACGGGTTGCCAGAC
GCAATTGCTCTGATCGTGACACATGATTTACGCGTGGCTTCTGAAAAGGATAGTTTTGTATTCGTGGCACTCGCTTGGACATGTCCACGGCAATACACCT
GGTGACCGATGAGCAAACTGAACGTGCCAACCGAGTGGTCGGTGATGTGTTGAATTCCGCAGAATGGAGTTTGTTTTTACCATTGGTAGAATTTGCTATC
AACGATTCAGTCCAT