Description :
From Genome Similarity Track
Location :
Scaffold_23:600196- 601561
Sequence
1365 bases(100 bases per row)
GCACTTTTTGCGATACGAGCTGCACCGATACGAGATCTTGACACCTGTTATGTTGGCCCGAGTATACGCGTAGCCCTAATAGTACACTTTGTTACTACCA
TCCCGTATTCTCGACACTGAAAGCCTTCGTGAGGCTGTCGCTGTGGTACAGTGCTGCATGGCTGCGCCATCCTCTGCGCTCTCCAAGCAAGTCAGAAGAG
AAGGTGATGAACGCGTTGTGGACAATGCTGCTGCGGAGTCTGCCGTTGGTTGTGTTACTGGGGTAGATAGTGTCGCTTCAGTAGGAGGGCCAATGACGGG
TGTTTCCCCTGCGATGCGATTAGGCGCTGAGGCCGCGTGTGGTGGCATGTTGCCGGTCCCGAGCGCGAGGATGTCGGGGCATCAGGCTCATTTGAGTGGG
CTCGCTGGGACCGGGTGTTTCGTCCAGACATAGGAAAAAAACGAGCTCGTTCAGGTCAAGTCGAGCGTCGAGACGACGTGTTGATAGGAGGCGGACGAGT
CGTTTAGCTCTACGCCGAGGCATTCGTATTGTTGGGTTTGCAGAAGAAGAAGTTGGTGGAGGAGAAGAACCGGTTGTTGTGCCGATGCAGAATGCTTTGT
GGTGAGGAACGATGCGAATGGGAAGCGCTGCGTTGGTTTCATAATTACGGTGAAAAAATGCGAATGCGAAGCGTTGCGTTAGTTTCATAAGATTGAGAAA
TCTCCGACACGCTCGTTTCGTAACTGCATGCATTCTTCCATATGTGACCAGTTAGCATTGGTAACGTGACCAAATTGTAACTTTCGTGACCTATTTGCAC
CTTCAGACCGTGACCAAGTGCTCGGATTGACCAGTTTACTCCTTCGACTAGCAAAGCTGAGGCGAAAAGTGGGTACGTGATCGGGGCTAATGGTAATAAA
ATATCATCTGATTGTAATATTACTTTTTAATTTATAAATTAAAAGTGGCTCAGCTTTTCAAAAGCTAACATATTATTTTAAAACTAACTCAGCCACTTGA
AAAATATTAGATACTTGATGATATTTTAAAAGCGGATGCTACAGCCCATGTTTTCTAAAAGGCCAAATCATGGACTTTTGTCATGAATCGATAAGTTCTG
TCCATGATTCTAAAAAGTAAATCACGAGGAGCGTGAAATTTATGCTGAATACGTTTGTGATATGGCGTGACAAGGGCAACCATATTCACAGTAGGGTGTG
AAAGTTGAAGCAGGAGTGCTCTTTGGCTTTGTCGGACATTTTTTTAACTACTGTATTACTACCTTTTGTAATGATAGATTTTGCTGTACTCATGTCAAAG
CATGGTGAAGTCATGAAAGCATAAAAACATATATGTTTTTGAACTTAGAAAGTATGTCAACTCGG