Description :
From Genome Similarity Track
Location :
Scaffold_953:6000- 9567
Transcript NameFunction/comments
Phyta_totarag11517sodium/glucose cotransporter, putative
Phyta_totarag11518hypothetical protein

Sequence
3567 bases(100 bases per row)
GCCCCTGTAATGCTTCGAGGCCCCGCAGCGCTTAGCTCTTGATAACTATGACAAGATTAATGTGGTGGTAATTCTGTCAGTCAGCAAAATTAATCAGTAT
TCAATTAaatgcatgtacagtacgCTCACAACGTGCAAATGCACTCGTACATGTCACTCCTACACGGTCTTGTAGTTCATGCGCGTGCCAGGGGCAGTGA
CGTTGCGAGCGTTCGCGGTGATAAACTTACGCAGTTTGTACAGACGGACAAGCCAAGCCTGATCAGCGCTCGCAATGCCTCACGTCGGAGTGTCACGGTT
GGAACGGACGCTGCACCCGCACACAAAAACGCTGGTCGAGCATCGAGACTCCAGAGtgtgctgctcctgttgtTGACCGCAGGGATTCTAGAGAAACTTT
ATTTGTAAGAAAGGTATCGCTGCCTGCGATTCGCAACGCAAGATGATGCCTTCCAGAAAATTCGCTTCGATTTGAAAACGAGATCGTCTCGTCCTGAGAC
TTCCACGTGGTAAGCTTTTAGGCGATCGAAAGCAATTAATCTTGAGTGCGCTGCTAGCAAAATGCGGCGGTAGTGGAATGTTGCAGCCGTAGAAGATACC
GAAGATATTGTACCGCTTTGATCAACAAGTGCAAGTGGAATAACAAAAGTCTCCGGCGCTTGCGTGACGTTCCACTACGAGTTGCTTGGGTTCTTGTTGT
CCTCCCCGGCGATGCTGCACTCCGTTGTGAACCGCATCTTTGCGCTCTGCCTGCCCCTTTCCGAGAACAGCGAAGATGTGCCAACACAGGAGGCTCTTGC
TATTAATTGTGCCTCAATTGAACGGCCCGCCTTGACGAGCTCGTTTCATTAGCAATGTTCAGCATATCCTAACCTTAGACGAATTTAAGCGCCGTCCAAG
GCGCGATCGCCGCCACCGTAGAGATCAATCGCGGGCTTTGGTGCACTTCTGCCAGAAGTTCTGGCGGTGgggctgcagcttcgtcccGTCTTGCAGCGCG
GCTGGTTAGGTGAGACTTGGCTCGGCTTTGAGCCAAGAGTGAACGCAGAGTTGAACCTCTCTATCAACAGGTGGTGCGGTTGTGTCCGTGTCATTCAGGA
CACCggcgtcgttgtcgtcacCGGCCGAGTTCAGTTCATTCTCTATTCCACTGCCTGGGGCGCAAGCGACTCACCTCCACTGCGCCCTACGTCGCGTCAA
GTTCAAGTCGTTGCCATTATGGTCGAGCTGTATACCCAAACGGTACCCAACACCTCCGGGGGCGCCAAAGTCAATGCCGTCGATATCCTCATCATCGTGG
CGGTGCTGTTCTTCACGATGGTCGTGGCCGTCATCGCCTCGATCCAAGCTGGAGAGAGTCACTTGGCCAAGTACTTCCCGTGCATCCGTCCAGCCAAACG
CAACGAAGACCAAGTGCTACAGTCACCCGGCGACGCCTACCTGGCCCCTGAGGCCACCCCGGGCAAGAAACTACCCGCCGGTGACGAGCGTGGCTCAACA
ACCTCCCAACAACGTCCGTCGGCCTCGCTGATTGCGCGTGACGGGCCGGATCACCAGGTCAACGCGATGTCCAACTTTTTCCTGGCCGACCGTGGCATGC
AATGGTACTTCGTTGGAGGAGCCCTATTTGCGAGCAACATTGGCGCCGAGCACTTCATCGGTATGGCTGGTGACGGAGCTCGTCGCGGCATTGCAGTGGC
CATGTACGAGTGGTACGCCGCCATTTTGATCTTGTGCTTAGGCTGGATCTTCTCCCCCATTTACCGCCGCTGCGGCGTGTACACGACGCCGGAATTCCTT
GAATACCGCTTCGGTGCGCCGTGTCGTCACTACTTGTCGCTCATCACGATCATTATGTACGtcttgacgaagatgagtGCGAGTATCTATGGCGGTGCCA
TCGTCTTCCAGGCTACTTTGGGTTGGAACCTGTACCTGGGCGCCGGCGTCTGCATTGCTCTGAGCGCCATGTACAGCATTGCTGGTGGTCTTCGTGCTGT
GATGTACACGGATTTGTTCCAGATGTGCGTCTTCACTCTGGGTGGTCTCGTGGTGTTCTCGTACTCGGTGAACCAGATCGGTGGCTTCGAAGGCATCAAG
GAGAACCTGGCTAACCAGGACCGCTCGGACTGGTTTCACCTGTGGAAGCCAACAGACGACGCCGACTACCCGTGGACGGGTATGATCTTCGGCCAGCCAC
TGGGATCGATCTGGTATTGGTGCATGGACCAAGaccttgtccagcgtgtGCTGTCTGCCAAGGACACAGCCAACGCGAAGGCTGGCTGCTCATTCGCCAG
TATGCTCAAGGTGCTTCCACCGTTCCTGATTGTCATTCCGGGCATCATTGCTAGCATCTACTTCGACTTCAGCAAGATTGAGGATGGCACCGACGCCGCG
TACCCGACTCTGCTCACGGAAATGATGCCGCACGGCGTTATTGGGTTGATGATCTCCAGTATCATCACTGCTATGATGTCGAGTTTGGCTTCCGTGTTCG
CTGCTGGTTCGTCGGTCGTTACCAACGACATCTACCTCAAGTTCCGCCCGGATGCTTCGCACAAACAGCTCGTGTGGGTTGGCCGCATGAGTATCCTCGT
TTTTGCCGTGctgagcttctgctggatCCCCATCATGCGCAATGGAACGGGTCTCTACGAGCAGATCGTTGAAATCCAGAGCTACCTGACCCCTCCCATC
GGTATCGTGCTCGTGCTTGGCGTTGCCTGGAAGCCGGCTAACGTGTACGGCGCGTTCTCGGCTATGGTGGTCGGCGGCCTACTGGGTTTCTCTCGTCTCA
TCTTCGTGACGATCAAAGACGACAGCATGGATGGCGATCTACCGGGCTTCtggaacaccttcttctACATGaacttccagcacttcgcCCTGCTACTGTG
GGTCACTGCTATGGTCGTGTGCGTCGTGGTAAGTCTGCTGACGCAGCACAAGAACCGTCCGTCGGAGGAGGTGCGCAAGTACATGATCCACTGGGACAAG
GTTCTGAAGCTCGACGCCACGGAGCTCGCCAAGCCCATGTGGGTGAACGTGCTCGTTGCTGGCAGTGGtattgctgctcttgccgtCACATTTAGCATGT
GGATCTACTTCGCGTAagcagagagagagagagaggaagTTGTACGCATGTGCGGTTGCTTCAGGGAAGCACCATGTAATAAAACTCAAATATCAAGTTG
TTTTCCATGTCAATCACGGTTTTCGTATTTTCCTTGCGAATTGATACTTTTGCTGTCGTACTCACTCAATTGCAGTGACGGCTGACCCATGGCCCACTTT
CCCCACGATAATGTACCCGTCGTCTTCGATGCTCGCAATAAACTCGGTAGCATCGATTTGCGTTCTCAGTCCAATTTGAGCACTAAAAGACTTGTCTGTG
GAACTTacatcaagcagcttggtgcACAGGATGGCCTCGCGAGAAGTGAAATACGGCAGTAAATGCTCCAAACTCGACGTGTACGTCCTTGTTGCGTTGT
GAAAGGCATGCTGTGCGTAGTAATACTGAAAACTGACGTATCGCACTCCCCATTCAGGATCGAGTGG