Description :
From Genome Similarity Track
Location :
Scaffold_1167:600- 2982
Transcript NameFunction/comments
Phypl_g12634hypothetical protein

Sequence
2382 bases(100 bases per row)
CGGTGTCCAATCCAAGCCCACCATCGCTCACTGGCTGTGGCGATCTCGAGTACCGAGACCCCCTCGCCACTTCATAACTCATATATAATTCTACCTTCCA
GTTCATACTTTCTCCTGCGCTTGTGTAAGCAAGGTAACGGACTCTAAGCCCGTTACACCTGGTAGCACTTCGAGATCCGTCCAACGACCAAGGTGAATGG
CACGTCCATGAGTGAAGCTTCTGGAGCCGCTGGTATCTCcctcgagcacgacgcgTTCCAGCATCTCTCGGTGTTGGTGAGGGATGCGCTACACCGCCTC
ACCGCGATGTCCGGAGATGGAGTCATCAAGACGTTGCTGACTGCCGGAACGGAACACCTACAACACCTGATCGTCCAGGAGTTCACGACACGTGAACTCT
CCGACCTCCTTCAGCGAGAAATGGCTCCCGCGCTGAACAAGAGCAAAACGGACATCGTGAAGCTCGATGTCTCCACCTACAGCGgtggaggcgaagaagc
gggcTCTCGGCAAACTTGTTGCCGATGACACCTGCTTTCCGGCCATGGAGGCGATGAAGTCAGATCTTTGACTCGCGTTGATGCCCCCCGTAAGATGAGG
TTGTCCGGCGGTCGGTGCTCCTGTCACTGAAGCAGGGACGCATGTCCATGCTCAAGTACACCTAGCGTGCGCGTCACCTCGTGTCGTGCATCTCGACAAG
CCCACTGGCATGACCGCACAGGTTCACGTCTTCGTGTCCGGCATGAACACATCATATCAGCGTTTCTACCCGACGCGGAAGACCCCGAAGaggccgtcgc
tgtcgcgTATTGCGAAGGCTACAGCGTGACGGCTTCACAAGCCATTGATATATCTCGGACTCTGACACGCGAGTCGGGTCTGGAACCGATGGGGGTGGAT
GCGATCCAGTACTACGGCGGGCGTCGTCGCGATCACTACGGCCGTCTCAGTCGCACGGTTCGTGCCCGATGCTATGCTTCCGTTGTGGCAAACCTAGGCA
GTGTGCCGCGCACCGACACCAATCCTGGCGAACGTCATGATCCAGTCCGAAGTCGCTGGTCAAACAAATAATGGCAATAATCCGTAGGCGCGGGCGCCCT
ACTGGTCTCGACAGGAGATATGGTTCTCGGGTGGCAGAACCTCCTCCTAGCCCTCATGTGCTTCATGCACAACTAATTGCCACCAcctccggcagcgacg
cgagaCTGATCGTTCTCAATCTCCACGTTGCCAGCGTGACTCACCCGAttcgtgcgctgctggattCAGGTGCGATGAACAGCTTCGTTTGAGTCGAGAG
TCTCACAGTCTTACCGGCGGACATACAGTTCCATGATGGTCCCGGCCACATGATCGTGAAGTATCCTGACAGAAAGACGCGGCAGCTgccgtggcgctcg
gcgATCTTCGCGTACGAGTTCGACGGTTTCTGCGGGTCAGTTGACTTCCTGGTGATCGAGCTGAGCGGTTCCTTTGACTATGTATTTGGGATCCCGTGGC
TCGCCCGTCACCATCCTCACATCGACTGGTTGACTCGGACTGTCCGTCCTCGTGATATCAACGTGAACGCTGGGCTGGCGTCCTTGGTTGTGACGCCCAA
CCATTGTCCACATGTTGTAGTCATGGATCCCGACTTCATGACTACTACTGCGCCCGAAGAGTGCGATATCCCTTCGTGTGCAGCATGCGAATACGTAACT
GGAGTCGGTCCTGAGTAGGAGTCTCAGGGCGAGTCCGACGCGGTTGAGCAGGGTCCCCGCGTCCCGATGAGTGAGGCACTCGGCGAAGGACATCAACGTG
GTCGAACATGGGTTCCCACGTCCTGATGAGCAGTGACTCTCGGATGAAGAAGTGGTTGAGCATGGCCTCCCACACGCGGTCGAGGATGGGTTCCCGTGCG
CGGTCGAGCGGGAGCTCCCTAATGAAGATAATGCGGTCCAACGGAGTATCCCGCATCCACACTTCCCGGGAGGTACACGACGACTGATGCGTCGCCGCAG
TCGTTATAAACGATGGTGACCTCGAGCTCTCTCCGGCTGCCCCAGAGAGACTGGCAGCGACTTCATATCAGGCCTGATGGGGGGCGACAGCTCCGCGCGT
GTCcacgaagttgaagtcgcaCGGAGGCCGTGCGACGCAGCAGAGATCACGCGATTATCTGTTCGTTCGTGGAAACACTTCCTCCGCGACCTGAAACACG
GAGAGATTGAGTAAATCTGCATGCTTGTAGCGGAGGACGCTTCGTCAGTCGCAACCATCAAGGTCAACACGCCCGACCGTGTCCAAAAagagccaagaag
aagagcgcccGAGAAGCGCGCTATGAGGCTCAATCGTTGCCGGCGCTGGAAGCGTCGGGCAATCCGGTCGCCTCTCTCGTCC