Description :
From Genome Similarity Track
Location :
Scaffold_431:600- 2700
Sequence
2100 bases(100 bases per row)
CCGTGCCGAGGCACTCTGCGCCTGCTAGCGCTGTGAATACGGCCACTAAACGCGTCGGCTTCGCGGCCAACATCGCCGAGGGCAGGGGGGTTCCGCGCGG
GGTGCCCGCTGTGGGCACAAGTCACTGTGGGCGTGACGATGAGGCGCGCCAGCCTTGCGGCGGCAGCGCCCGAGAATCCGACCTTTGGGTGTTCGGATTC
TCTCGAAGCTGATTGGAGAATCAAATGTGATTCTCAGATAAGTGGGGGAGGATGTAACGGGGTACAATCAAGTGTACCCATTACATGAAGAGTGACGGGT
GTCACTCTCCCGAGTACATGGTACATGGTACCAGTAGCTCCGCAAGCCAACCATTTAAGTTTGCGTGGGCTTTTGTATAGTTAACTTGTAGTTTGTATTA
CGACCAAGTTAACCTCTACCAAAATACAGTCAGTCTTATAACCTACTCCTTTGTAGCAAACCGTTCCCTTTGATGCCGGGAACAGGTGAACTGCTGTTCA
CCTGGATAGTAATATCCGCACGCCCTTCCTCTGTGCATTGTGCTGTGTGACCCCGTCACATTGGATCAAGATATAAAAGCCAATTTATTCATTTAGTAAG
GCCAGCGAGTGGCGAAGGTAGCGCAGTCTATAATACTCGAGTGACCCTTTTAGATTTCCTGTCCACAAACTAGAGTCACCGAGGTGAACTTCTAGGAATA
GGAGAGACAAAGGATCGCAGTTGACTTGAGATTATGCGGGCGAGGCTTGGTAGTCGAGTGTTGGTTAGGAAGGAAATCCGAAATTGAATTAGAATGAGTT
AAGCAAAACTGCTTTTAGGAGTCTGTCCTACCGTGTCTTACCAACGAGTACACGAAGTCCTAGCTTCTAACTCCAACATGTTTTGTCGAGGCTGCGAAAA
CTAAATGTCGATTGTGGTTGCAGATCCCATGCAAACGGCAACTTCAACTTGACCTTCTCTCAGCCAATCAGAATCACCAAATCCGGGGAACCAGCCAATC
ACATTGCAGCATACAGTACAACCGTACGCCTTGGCAACAACTCCACAGCCGCACGTACCTCGATTCGGAGTCGCACAACTAGACTGCGAAGTGTCCAATC
GCAACACCCCCACTCAATTCGCAGTCTACCCAAGTAAGTCAATGACGTTACTTCTCTCGAGCAGGTAGCGAAGAGTCTTCGTAGACAATCCCTTCGTCAG
GAAGTCAGCGAGCTGGTTCTTGGAGTCGACGTACTCCAGCTCAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN