Description :
From Genome Similarity Track
Location :
scaffold_47:600- 2372
Transcript NameFunction/comments
g2022.t1 hypothetical protein VITISV_004379

Sequence
1772 bases(100 bases per row)
GCTCCTGGCCAGCTCAACTGCCGATGGTTGAGTTTGCACTCAGGAACGCGGTGCACGCCTCGACGGGGTTCGCGCCGTTCTACTTGAATGGGCTACGTAA
CCCCCAGGTGCCGCTCATGCTTGGTGGGGACACCGGGTCTTCAAGCGTAAATGGGGGAGAGGCTCGGTAAGAGCTTTCCTCCCAGATTTCCGATGTGGAA
CCAGCCGCGTTGCGGAAGAAGTTGTTGACGATTGTCGGCAACCAGCTGAATGTGATCAGCCGGGTGCGAGATGCAATGGCTCTCGCACAGGATAAAGAGA
AGGAGTACCCAGACCAACATGGAAGAGGAACCTTAAACGCGTTTAATTTGGGTGGCTTAGTGCTACTCGACACTAGGACCCTACCGCTTAACACTGTTAG
CTCAACGGTGAGCAACAAGTTGAAGCATCGCTTCATTGGACCCTTCAACGTCCTCAGTAGGCACGGCGCTGCCTACACGATCGACTTGCCTAAGTCGATG
ACGACCCACCCGACGTTTTATGTGGGCCATCTGAAGCGGTACCATGACCCTCAGGGTCAGGCGGCTCCTCAAGAGGAAGAGGGTGGCCGCGAGGAGGAGA
GCAAACCTTCTCGAATCGAGGCGGAGCCTCAGGCGCAGTGCACCCCAGTCGAGTGACTCCCAGGGACAGAGCCGTACCCCTGTAACGGGTACGAGCGGTG
TGAGTACACCGAGGGGCCGGCAGCATGGGCCCCATTGCGCGAGTCGAAGAAGGACGGGGAGTACGCGGCTCCCGACAGGACATCATCGCCCGTAGGTCGT
AGACCTCCTGACGCAGGGCATTAAGATCGTGCGAAGGAGCTCTACGGTCTACCCGACCATGGAGAGCCTGTATCTCGAGACGCCGGCCTCCCAACTCGCG
CCAGGTTGGCCGACTGCAGCAGCTCGGCCGCTCTCCCCAAGATCACGGGCAATCCCCAGCGCAAGGACACGCGCTCGGAGGAGACGGATCTTCTCCTGTT
GCAGAGCAATAACTTGGTCAAGTGGCCTAGTCGACGGCCTTGGAGCCTCCGACGTCGAGGACGACTCGAAGGAGTAGTCGGGCGAGGGCCCCTCCAGCTT
TGCTCGACTGGAATGGAGAACGCCACTACCATGTGGAGCGGGTTCTCCAGGGTGGGAAGCGACAGCTCCGAGGGGTACCCTACTTGGAGCCGATTGAGCG
GCTCCAAGCTGACTGCCCGAAGGCTGTCGCGTACTGGGAAGAGGCGCGGCGGCAGCCTCGTACGTAGTTCGCAGCTTCTTAGCCGCAGTACGAGGTTGGA
GCACTGGTGATTGTGCTCCATACCCGAGCTCGTCAAGAGCGCAAGACTGAGACTCGGTTCTCAGTCTCCCCATCTCACGATAGAGCTGCCGTTTGCCCGC
AAGGTAGACAAACAGGACACGAAGGTTCTAGAGCTGGAGAATGTGCTCCAGCTGATCTTCGTCGCGGAGTTCTTGGAACTCCTGGGTTGAATGGACTTTC
AACCGGACCCATCGCCAGAAGTGGTCGTCAGCGTCGGTCCACGAGGCGGTGTTCTCAGGGAGAACCCACGGATAACTCTACGCGGGCTTGAGACCTCCCT
TGGTCTCAGGCTTCTTGCGAAGCATGGTGAATTTCTTGAGAGGAATTCGGTGCTACGCCAGAAGCAACGCACCTGGCAACAGAAAGTTTGCTTTGGAAGG
GAGGAACCAAGGCCTGCTCATAGGCGTCTATAGAGGTATGAGAGGACGTGGGTCCCTAATAACGTACCGAGG