Description :
From Genome Similarity Track
Location :
Scaffold_3419:600- 2237
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_3419-fgenesh-gene-0.0Secreted RxLR effector peptide protein

Sequence
1637 bases(100 bases per row)
CTGAGCCAGGGCGATCATGCGTAGGACTTGAGCGTACTCGACAGTCGCGCCCTTCAACTGGAAGAGCAACTTCGAGACGCTGTTGAAGCGGAAATGCGAG
AGCCGGAAGCCCACTGACCGCAGCACACACCGTAGTTGCTCGAGCTCAATACGACCACTTCGCTCGCGGTCTTTCATTTCGAGTGCGAGCTTGAACTGGG
CCTGGCTCACACCCGCTGCCTCTAGACACTCGAGACAGGTCCGTACAAATTCGGTACGTAGTTCTACGATCTCGCTAAAGTGCGTGACGACTTTGCTGAG
CGTGGCAACGTCCACCTGGAGAATACTGGCCACGATCATAAAATTGCGTAGAATCTGCGGTTGCAGCAGCACCATATTGATGATCACGGGCAGCGGCAAG
CCGACAACGATCACGGCCCGAAGTGGAGACGAGTAGGTAGAGAGCAAGCCCAACTGGTAAAAGATGCACTGGCACAAAAGCGCGAGGTACAGTCCGTTGA
GCATCATGATCACCATGACTACAAACTGCCAGGCGTTGCGAGAAAACCACTGGATCTGGACGCTCAGCTCCGCCGAGCCGCGGCGGTTTGGCTGCTGCGG
GTGATGGTGAGGAGTGGGGGAGAAATCGATGCTGGTTGTTGGCGTGTCAGCTGTCACCGTGGACAAGGTATCACTATGGACTCGTGGCTTGGTCTCACCT
TTTCGAAACTGAACGAACCAGTCGACCGCGTGGCGACCAGCCGTCGCTAGCAACTGGAAGCCCGTGTCTCGCTCCACGAGATAGCGATGCTTGCCACGCC
TCTGTCGTTTCATGGCACTGTACTTGGCATCTTGACGCTCCTGGACTTCCTGCATGACAAGCAGCGCGTCGTTGGCCATTTCGTTGTGGAGTGCGGCGTT
CTCTTCGAGGGCGATCGCTTCAAGACACGCCACTGTGGTTTGCTGATGGGTGAGCCCTTCGACACGCAAGAGCTTCACGATGCCGTTGCGAAAGAACACG
GCGACGAGTACGTGGAGTGCCACGAGTGACCACGAAAAGATGAGGAACACGAGAACAATCGCGTGGGACTCGGCGTGGAAGCCGTTGACCTGTTGAACCA
GCACAATACCACCGTCGATTGACCACGCGACGCCAAGCAGCAGTAGCCACATGGAGATCTCGACGTCGATCATGTGCGTGATCTGGTTGTCCTGTGCCTG
GCGGACGTACTTGGAAAAGGGGAACAACTCGGGCAGCCCGTACCGACGCAGGAAGAGGTGGCGAAGCACGCGGAGTTCCACGAGCTCTCGGGTCTCAGAC
TCACTCTTGTCATTGCTCTTGCAGGTCGTACACCACCACGACGGCCAGCCCGCAAGCCCATGGCTTTGTTGCTGCTGCTCTCGCTGTGCGATCGTTCTCG
CCAGGTCGCTCGAAGTGAGCAGCTCTGCTTCTTCTAGCTCATAGTTCTCATGGCGCAAGGCGAGGAATACGCAAATGGCCTGGAGAATCAGCGCCACGGC
CAAGATGAAGATGGTGAGGTCAGCGCACTGGAATGCGACGATCGCATCGCTGTATGCGCTCACGTGCGTAATCTCTTTGTAAACTTTGATCGCGACGCCC
AGGAACCCGAGAATCATGAGCTCGCGGTACACTTTGC