Description :
From Genome Similarity Track
Location :
Scaffold_2065:600- 2023
Sequence
1423 bases(100 bases per row)
GCGAGACCGGCAAAGGACGACCCACGATCAGGGGCGAGTCGCCGGGAAACATCCAGGCGACATACCCGTTCCAGATCATAGCGATGGATCACATACATTC
GCTACCCAAGTCGTACAAGGGTAATACGGAACTGTTGATCTGGGTCAATCTGTTCACGGGATACGTGATCGCGAAGGCCAGTTCCTCCCGAACGGCGCAG
ACGATCGCCGAATCTTACGAAGAGTGTGTGTTCCGGCGATTTGGTGCTAGCGAGGTGATCAGGCACGATCGAGAGCCGGGAGTTATGGCTGACTTCTTCC
GCGCCTTTAACAAGATCCTGGGTATGTACCAGCGAGCGACGATGGCATATCGACCTCAGGCTAACGGTACTGCAGAGCGAATGGTACAGACGGCGACGAG
GGCCCTGAAGATGTTCGTGGAGGATCTGGATCAGAGGGAATGGGATGAGTACGCAGAGCGATTGACCTTCGCGATCAACACGGCTCAGGATCGGGTCCGT
GGGGACCCCCCTTTTTATATGGTGCATGGATGGGATCCTCGATCGACGCTCGAGGCAACGATACCTTTGGGTAGTACCCGGACTCGGGATCGGGATCCTC
GACGGTGGCGTTATCGGATCCAGAAGCACTACGATCAGGCTCGGAGTCAGGTGAATGATCGACTACGCGAAGCGATCGCGGATCGGGCCGATCGACACAA
TGAAGAAGTTCGACCGCACTCGATCGAAGCTGGATCTCAGGTGTGGCTGTACCTGGATCGAGTGAAAGAGGGCTATGCCCGGAAGTTGGCCCACCTGTGA
CGATGGAATGGATCAATCTGAGTACTTCGTGCTACGCGTATGGAAGATCAGCCTCCGCGTCACTTCTATTCTTGGGGTATGGTCGACTGGCTCGCTATTC
GCGGAAGTCGATCGTGGAGACGGCGATCATGTCACGGCTGGTGTTGGGCGCTGACGTTGGGGTTGAACTTGTTGCGGAGACGCGGGATCCGCTGGGCTGG
ATGGTCCTGGGGGTGGGCGCGGTACTGGTTCCGCCAGGGATCATGGGTGTCGGCCTCGATCAGGGCCGTTCGGAGGTCAGTCGGTTCACCATGGTGTTGG
GTGGGGTTGCCGATGTTCGCAGCGCGAGATACCACGCCAGGATACCAGGTTACAGCGTCCCGCTGTCGCACCGGGATCTGCAGGAAGAATGGGTCCAGCA
GCAGATCGACGTCTGCCCACATCTCTCGCATCATCGGCAGCATATCGACGAGGAGTCGGCGCCACCGATCACCGAGGCGGATCCGTCGGGCACGACGATC
GCGATGGTATCGCTTGACGATCTGATCCCGACGCTGGGCGCCCGTGATCGGGAGATAATGAGTTGTTTCCCAGAAAGCCTGGCGATTCTGCTCTTCGAAC
TGAAGATAGGCAGCGGCGATCCG