Description :
From Genome Similarity Track
Location :
Scaffold_951:60- 3255
Sequence
3195 bases(100 bases per row)
GGTATTTCGGGTGAAATCCATAGGAGAGCGTTTATCGATTTAGACGTTTGGTGAATCTGGAGGGCGTTTTTTCAATTCCAAAACGACATTCCGGGTCCCA
CTCGAACAGGCCAAACGGTGGTATTTGAATGCGAATATGCGGCGAGCTCGATTCGCTTCATGGTTAACCACCCCAAAACCCGCTGGCACATGTCTAGAGA
GCGTTACCCAGAGGTACTTATTCCCGATTCTAGCCAACAGCTCATTGGTTAGGAGACATCGGAATAACACCCTCCATGGGGATCCAGGGTGTTTAACACA
CCGCGGTATAACAATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATGATTACCACTGGGGATGCCCACGGGGACGTTGAGAAGCTGATGATCTTG
GCTTGCAGCAGGCCCTTAATCAGATCCGATAGTTTTTCTCGGAACTGAGGTGCCACCTTCCGCACCCTTTGAGCGATCGGTTTCGCGTCGCCGACATCGA
TGTCACATTTGACTCCGCGGGCGGCGGGCGGTAACGCATTACCTTTACCAATCAGCAGATGTCGGCTTTCCCAGATCTTCTGACGTAGACGATCCACTTC
AGTGGGTTCGTTCGCCCCTGGATCCACTTGGATATCATCAATCGTGACCTCCTCTGTGGTCAGTGGTACCTCCAGGATCACCGCCATGCCTTCTCCAAGC
TCCTCGGCGTGTAGATCCCCGCCTTCACGGTAGCAGACTTGTTCATCTTCAGTCTTTGTCGGATCCACCATTGGATCCAGGCACCGCGACTCTCCTTCAA
CCGCCACCCCTTCTGTCTTCGTGGGGTCGGGTATCCTGGTACTGGGGAAGCCACCTTTTGGATCGACTTGATCCTCTGGTGGGTTTACCCACGATGGTTC
CTGTTTAGCTGGTGCGGCCACTCTCGACAAGGATCCAGACACTTTGCCCCATGAAATGTTAGGATCCACTCTGGGGTCAGCGGGATCTGGCGGTCCGGCT
TCAGCCCTTTGCGATCCCTCATCCACCGATCCTGCGTTATCTAGGGGCCGACTCTGGGGATCGTCCCCCGTCGTGGATCCAACCTCCCTTGCTTGGATCT
CAACCCGTCGATCCCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCGCCGGGAGCTCCACCTCTCCGAG
GGATTCGATCTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGCCTAGGGATACCGTCC
TTCGCTAACCATCGCCCGATCTCCTCATAATGGTCCGGTAATACGTCTCTTATCGCTGACGTTCGTGACCTGGAGGTATTGTGATCGACCTGGCCCCTGG
ATTACGGTAGGTACCCATTTCGCGCCCCGTGTGACCCGCAGTTTCTCATGTTCCACCCACTTTAACCGGTCTGGCAGCTCCCAGGTTTCCCCGGGCTCGA
TCCAGGTTGTCTTATCCGCCCTTATGATCCTCATCTTCGCTCCATACGACGGTCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGT
CCCATTCGCTAGATCCAACCTCACTCCGGCCGGTCCATGAAATCCATCCCGAGGATGGCGTCTTGGCCAGCGAGATCTCCAACCCAGATGTCAAACCAAT
ACACCAAACAACCTGCCAGCGTGATCTTGATCCGCGTTCTCCCATTCGTACGGTACAAGCCTTCACCAATCCCAACACAGTCTTGGATCCGACTCCCATC
CACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCTAGTATAGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTGATCTTGCTC
CCTACCTTGGCTTGTCTGAACCACTTTTCTGGGGCATGGTACTTCCAGTATCCACGGGACTCCCCGGTCAGCAGATCCATGGATCCAGCATCCTCAGATC
CACGGGATCTAGTGACCTCGCCCTTGGTAGGCTCAAACCATCGGCCATGTTGGCGCTTCTCCCAATAACCACGTGCCTCTCCCCTTTGTAGATTCAGGGT
TGAAGAGACTTCGGATCTGGCAAACACATCCACTTGGCGCAAACTAGAGATCTTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCT
AGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAGTGCAGTACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTC
CTAGTTTAACAACTTCTCGGCCACTTCTGGCAACATCCCTCGGTGCTTGGCCGGATCAAACCATTGGCGGATCTGGTTGTAGAATTCTTCCATCGGGCAC
TTGCCGACGTCGTGAATCTCGCCACACCCGCGACACACGTAGAAGCAATGATCCCCGGGATGACCTTTCTTGCCACACTTCTCACAGACCAGGTGTTTCC
AGCATCCAGATTCAGTGTGCTTCCGGGATCCGCACTGTGAACACCTGACTTGTGCTGCCCCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCC
GGATACGGTATCCCCCGGTCGAGAGTTGTCTCCTGTCTTCGCCGTTCGATCGTTGGACGCAGTGAGACAGACCCGACGGTAATCTTCAGGGTCGGAGTCC
GAACCGTCGGATCCTGATTCAGTTCCTGAGTCGGGCGCCGTGACTTGGTGGACACGTCGAGCTGGGGCCGTAGGCGTCGGAGCCTTTTGGCGATACTTGC
CGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACCGCCCGCAGCACTTCCTCAAGCTCGTATGCGTCGGGAAGTCGTAACAGGGTCAG
CCTGTCGGCCAGATCCACGTCTCCCACCGTCTCGATGAAATGATCCACGTGCTCCCGCAGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGT
AGACCGGCCACATTTAGTCGATGTAGGTATTCTAGCGGGGATTCATCCCGATCTGCGGCGAGCGTGGTAGTATTGTCGTGCCACCGACACTCCCAATCCA
CAGTACTGGGTCTGGAAGCTGCGCAGCAAATCCGGCCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATACCAGTTCCTGGCTGGCCCCGCGAG