Description :
From Genome Similarity Track
Location :
Scaffold_2217:60- 3151
Sequence
3091 bases(100 bases per row)
CCAAGGTTTGTCAGGTCACTGGATCCCGTGGATCTGAAGAGGTCGGATCCATGGATCTGCTAACAGGAGAGTCCCGTGGGTACTGGAAGTACCATGCCCC
GGGAAAGTGGTTCAGACAAGCCAAGGTAGGGGGCAAGATCAACAATGAACAAGCAATCCTACTCCTAGATAGTGGTGCCAAGGTGTCTATACTGGATACC
GCCTTTGCTCGTAAGGTTGGGTGCCAAGTGGATGGGAGTCGGATCCAAGATTGTGTTGGGATTGGTGAAGGCGTGTACCGTACGAACGGGAGAACGCGGA
TCAAGATCACGCTGGCAGGTTGTTTGGTGTATTGGTTTGACATTTGGGTCGGGGATCTCGCTGGTCCAGACGCCATCCTTGGGATGGATTTCATGGTGCC
GGCCGGAGTGAGGTTGGATCTGGCGGATGGGACACTTTGTTTCCCTGATGAGATGCGGATCCAGCTCAGCGGACGGCGGCCGTTGTATGGAGCGAAGATG
AGGATCATAAGGGCGGATAAGACCACCTGGATCGAGCCCGGGGAAACTTGGGAGCTGCCAGACCGGTTAAAGTGGGCGGAACATGAAAGACTGTGGGTCA
CCCGGGGCGAGAAAAGGGTGCCTACCGTAATCCAGGGACCAGGTCGATCACAATACCTCCAGGTCACGAACGTCAGCGACAAGAGATTATTACTGGACCA
TTATGAGGAGATCGGACGATGGTTGGCGAAGGACGGTATCCCTAGACGACCTGGATATGTGTCAGTGGGATCCCGCCGCTACAAAGAATGGCAGAATCTG
GTGTACGAGGCGACTACCGAAATCGAATCTCTCGGAGAGGTGAAGCTCCCGGTGGGACCAACTGACCCTTTGGTAAATCGGCCTTCATATCCAACTCCGC
GAAAGTTCCTGCAGAGGGATCGTCGGATTGAGGTCCAAGCGATGGAGGTTGGATCCAAGACCGGGGATGATCCCCAGAGTCGGCCTCTAGATAACGTAGG
GTCGGTGGATGAAGGATCGCAGAAGGCTGAAGCCGGACCGCCAGATTCCGCTGACCCAAGAGTGGATCCTAACTTTGCATGGGGCAAAGTGTCTGGATCC
TTATCGAGAGTGGCAACACTAGTCAAACCAGAACCGTCGGGTTTAAACTCGCTAGAGGATCGACTAGATCCAACTGGTGGTTTCCCCGATACCAGGGTAC
CTGATCCCACGAAGACAGAAGCACTGCCAGGTGAAAGAGGGTCGCGGTGTTTGGATCCAATAGTGGATCCGACGAAGACGGAAGATGAGCAAGTCTGTTA
CCATGAAGGCGGGGATCTACACGCCGAGGATCTTGGAGAAGGCATAGCGGTGATCCCGGGAGGTACCACTGACCACAGAGGAGGTCACGATTGACGCTAT
CCAAGTGGATCCAGGGGCAAACGAGCCCGCAAAAGTGGATCGGTTACGTCAGAAAATCTGGGAAAGCCGACATCTGCTGATTGGTAAAGGTAATGCATTA
CCGCCCGCTGCCCGCGGAGTCAAATGTGACATCGATGTCGGCGACGCGAAACCGATCGCTCAAAGGGTGCGGAAGGTGGCACCTCAGTTCCGAGAAAAAC
CATCAGATCTGATTAAGGGCCTGCTGCAAGCCAAGATCATCTAGTTCTCACAACATCCCCGTGGGCATCTCCGGTGGTAATCATCATCAAGAAGAACGGG
GTGGATATACGTCTGTGCATCGATTACCGGCTAGGTAATGGCCTGACTCGATTGATGGTCTATCCGATGCCTCTAATTAATGAGCTATTGGAAGATTTGG
ATAAAGTACTCTGGTACTGTTCTCTTGACATAGCCAGTGGTTTCTGGGTGGTGACTATGACGGATCGAGCTCGCGCAATATCCGCATTCATAACACCGTT
TGGACTGTTCGAGTGGAACCGGATGCCGTTTGGATTGAAGAACGCACCCCAGATCTACCAACGCCTGATCGATAATGCCCTCTATGGATTCACCCGAATA
CCGGAACCCGAAAAGGGTGGATCCGGGGAAGATCATACGGAAGTGGATCCATTCGAAGCAGGAGAGCCAGGGGATCCTGGAACCCCGTCTGTGTTAGGAC
GCAAATCTTATATCGACGACATTCAAATCCCGGGATCCCTGTTGCGAGAGAGTGACATCCCTACTGGAGGCGTGTACTAAGTGGAATCTCTCTATCAGCG
CGGTGAAGGGCTATTGGGGTATGCGCAAAGTGGATTACTTAGGTCATCGAGTCTCCAAGGAGGGGTTTGAGGCGAATCCTAAGGACCTGGCTTCGTTGGC
AGACTTGTCCCTCCCACAGTCGTTACGGGGGATGCAATCCTTCTTGGGCAGTTTGAACTACTACAGTCGGTTCATCGAGGATTACGCACTGTTTGCTGCG
GTACTATATGAATTGAGAGAGGTAGATTTTGCTGCGATGACCACTCCAGCTGTCCGGATCAAAATCCAACAAGCTCTGGCCCTGGAGATGTCAGATCCAC
GAAAGGGATCCCAAGTAGTACGACGCCAAAAGAGGACTTAAAACAGGAGCCGGATCCGCCCCGGGACCAAAAGGAAGAGGATCCAATCAGAATAGAGACG
ACGGACCAGAGTTCGACAGAGGCGGAACCTCGGTGGATCCGAGCTCAACACGCATTCGTGGAGCTGAGGAACAGGATCGCGACCACACCTATCCTCCGTC
ATTTCGATCCGGAACGTCAACCTACGGTTATACTTTATGCCAGTGACTGGGCCGTCTCAGTAGCTCTGGTACAAGAACATGAAGGGATCTGTCATCCAGT
CACCTTCGTCAGCCGGACACTGAAGCCGAATGAATTGAACTACGGGGCAGTGGAGAAAGCGATACTCGCGCTTCTGCGCGTACTGGATCTCAATTACAAC
CTACTGGTGGGAAAGTCCATCCGGATCCTGACTCGACACTCTACGCTAGCCTGGCTGTTCAAGTCGGCCGGGTTGCAAGGACGTTTGGGGCATTGGGCAG
CTTTACTCTCACCTTGGACACTGGAGATTGTGAAATGTTCGAAAGGTGAAGACGAGATCCTGGGAGTCTTGGCCGCGAGCATCACTCCTCG