Description :
From Genome Similarity Track
Location :
Scaffold_775:60- 2949
Sequence
2889 bases(100 bases per row)
CTATACAATCAAGGAGATTGTAGACGCCAATCGAGGACGAGATCAACATATTGAGGCAATGGAATGCGTGAAGGTGACTGCGACCGAAGAAAACAGCCAC
ATGGTAGATGATCCGTCACGAAAACGGTCCAGCCATCAGCAAGACGCCATCTCGATTAAAGATAGTGGGTTGCAAGAACAGGCCAAACGACTGGTCGAGA
ACTACGAAGCGGTAAGGATTGACACACCTGCGGAAAGGGAAAAGACAGTGAGGTCTCCAGCGGTGATCGACGCGATTGAAACCATGAATGAGATCGATCG
AGTTATAAATCCACCAACTCCGACGGTATGCAAGTCGAGCGGAATCGAGGACAACGAGTGCGATAGAGCTGATTCAGACCATAAAAAGTCCATCCATGAG
TCAGCCGGGATTAAGAGCGCAGATTGTGAGTTCAAGAACGGGTCGATCGACAGGCGGAGGAAATGGGTAATACCAAGATCGACGAGGAGATGAAGAAAGA
AACGGTATCGTCTGCAACGATATATTACCACGATGGTGGCGAGTTGTTCGCTGAGGATGTAGACCAGCATATAGAAGTTCTACCCGAAGTTATTACACCC
GCGCAAGAAATAACAATTGATGATATCCAAGTAGGCGATCGAGGCGTCCGAAGGACTGATGATCAAGGTAAGTTGCGACAAGTGATTTAGAGAAGTCGCT
TTTGGCTGATTGGAAAATGTAATGCCCAACCATCTGCGGCGCGTGGGGAATTTACGAAATAGATGCGGGTGGGGCCAACCCGGTCGCGCAAAGGGTCAGG
CCTGTAGCTTCCAATTTTTTGAGAGAAACACGCCAATCCGATTAAAGGGTTACTGCCGGCCAAGATCATCCGACCATCTACATCACCACGGGTGGCTCCT
ATAGTGGTGATCATCAAGGCAAACGGAGAAGACATAAGGCTGTGTATTGATTACAGTCGGGTGAACTAGCTGACTAGGTTGATGGTGTATTCGATGCCTC
TGATCAGTGAGCTATTGTAGGACATGGACAAAGCCATGTGGTGCTGTTCCCTGGACATGGCGAGTGGTTGTTGGATGGAAATGCCTTAAAGAGCAATAGC
TATTTCCGCCTTTATCACACCATCAGGGTTGTTTGAGTGGTTACGGATGCCTTTCAAGTTAAAAAACGCTCCACAGATTTACGAACGGTTGATCGACAAA
GCTCTGTACGAATATCTAAAAATTGGTGCAATATCCGAATCGATCACGGCCGGGTCACCGAAGTTGATCGATTCCTTCACCGATGGTGAACCAGATACTG
ATCCGAAACCATCCGTGTTGCATCGAAGATCCTATATCGACGACATATTGATACCAGCTACGTCGTGGAAATTCCTGTGTGAACAAGTGGGAGGTTATTG
AAGGCGTGCGATAAGTGGAATTTGTGGATCAGTTTGGCCAAACGTTTCTGGGGACGTCGCAAGGCGGAATACCTAGGACATCAAATCTTGCTCGCAGGTT
TGGAAGCTAATCCGAAAAGATTTGGGATAATTGGTGAACATCCGGCTTCCTCGGACGCTGCGATCGATGCAGTCATTTTTGGGAAGTCTTAACTACTACA
GTCGAATTATTGAAGATTTCGCAATTTACGCATCAGTGTTGTACGAGCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NCTGAGAAGGGAGAAGATTAAATACTCGGCATGCTTGCGGCAAGTATAACACCTCGTGAAGAAGTAGATGAAGTGTTGATTGCTATCGCCCCAAGGAAGC
AGCCAAGACAGACGATAAGCATGCCACCACCCACAGTAGGTGTGAATGAAAATCTGCTGGTAGCCAGTTTCGATGGATCAGCCAGGGTGAAAAGTAACGG
CGGAGCATACAGCGCGATTATATAAAAACTGCCAGAGTGGACGATTGTGGCTGCTGCTTCCGAGTTTACCCCTGATCTGAACGTGAATG