Description :
From Genome Similarity Track
Location :
Scaffold_478:60- 1991
Transcript NameFunction/comments
Physo_145099reverse transcriptase

Sequence
1931 bases(100 bases per row)
GTCGACGCACCCTTTGTAACGAAGGGCTCCGCCAATAACAGGCGTCGAGGTGAAGACGACGTGTCGGCTCCGGGGGCCGACGCTGCTGGCGGTGCGGACG
GTTGCAAACGTTCCGCACCGGAAAAACTTGCATGCTGTCGTGCAGCCGGGCTGCACGACGAAGCGCCGGGCGACCAAGCCGGGCTTGAAGTCGCTCGCCC
GCGGGATGAACCCGCCGGCGGTACTAAAGAAGAACACCCGTCCACGGCTGGGCCTGGACGAGGTCAAGAACCAAGCGGAGCCGGGCTCCGCAAAACAAGA
AGACGGCGCATGCGAAGGTCGCTGCGCAAGTCTCGGCCTGGGGCCGAGACGCTACAAGGAATGTCTGCTGGGCAGACGGAGGCTGAAAAGCCGGACGTCG
AGACGTTGAATGTCTTGACGCGTACCTGTGCCGGGTTCCGGTACAGGGAGATGACTCTCGCTAACCCTCCGACGCAAGCGTCGGAGTTGACTTCGCTTCC
AGTCATGAGCTGGAAGCGCTTCGCGCGTGACTTGCACGATGAACGCATCGAGCAACTATGCATTCTCTCGGACGCCGAGAGAACGAAGAGCGAGAATGAA
GAACTGAGGCAGTTCTTCATGGAGACCACCACTGAGAGCGAGGACACTCTCAGTGCGAAGACTAAGAAGGAGCGCTTTGAAGAGCAAAGCTGGGACTCGT
TGAAAACGAGTCCCTACTACGAGATCTTACGGGAGTACGCGGACGTACTTCCGGAAGAGATTCCTGCGGAGCTTCCGCAGGACAAGGGAATCCAGCACGA
GATTGATCTCGTGCCGGGCACGAAGTACTGTGTCACGCGGCAGTGGCCACTGCCGCGAGAGCAGGTCAATGCGATCGACGACTTCTTCGAAAGGCGTCGC
AAAGCTGGACAGGTGCGGGAATCGAAGTCCCCGCACAGTGCCCAGACGTTCGGTGTCAAGAAGCCACAGGGCGGCTGGCGCATCGTTCATGCGTATAACA
AGCTGACCGATGCGACGATACCGGCGCAGACGCCGATACCTCGAAAAGATGTTATCATCGATTCGATGACCAGGAGCACTATCTACAGTGCTCTTGATGT
GCGCGATGGGTTCTATCAGATCCTCATGCGTGAGAGCGACATCCCTCTCACGGCAGTGAGCACGCCGAGCGGCATGCTCTGGGAGTGGCTAGTGATGCCG
CAGGGTCTGAATAACGCCCCTGCGACCTTCAACAGGTGCGTGACGCACTTGTTGTGCTCGGTGCGCGACTTCGCACCGAGCTACTTCGACGATGTGTTCG
TCCACAGCCGGGCTGCGGACGGGATGAGCGATGTTGAGATGCACAAGGTGCATCTCCGGAAGCTGCTTGCGCTCATGCGCAAGGACAAGCTCTATGCGAA
TCTGAAGAAGTACATCTTCGGGGCGAGCGAGATACCCGTGCTCGGGTGTCGCGTTGGGAAGAATGGTGTCCGCCCTGACCCTGAGAAGGTCAGAGTGATC
AATGAGTGGCCGACGCCGTCGAACGTCAAGGAACTGCGGCAGTTCCTTGGCTTGGCCACGTACTTGTGCAAGTACGTGAAGGACTACGCGGGCATGATAC
GCTTGCTGTCACAGCTCCTGAAGAAGGACGTCGAGTGGGTTTGGACTGCTGAGTGTCAGCAGGCCTTCGATGCAGTCAAGCGGGGCTTGACTGAGGCGCC
GATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTTGTGTGTGACGCATCCGACTTCGCAATCGGATGTGCGTTGATGCAGCACGAGCACGAGGGC
CGTGATCGTGTCGTCTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAACTACCCGGTACATGACAAGGAGCTCCTTGCAATGAAGTACGCACTCG
CGAAGTTCCGAGTGTATCTAAGAAGAAGACC