Description :
From Genome Similarity Track
Location :
Scaffold_3501:60- 1632
Transcript NameFunction/comments
Phypl_g15864hypothetical protein

Sequence
1572 bases(100 bases per row)
ACGCGCGGTACCCGCGTGttccggtgctgctcgccctAGGATCGATGCTAGAGAGCACGGGCTCCACTCTTGGTGGGGGAGGACCTGAAGAAGCGCCAAG
CGTATCGGCGCTAGAGTCGAGTGAAGCTGATACTGCATAGCGAGCCACACCGATACTGAAACCGGTAGCTCCGTCGGTACCCCCGCCGACATGTCGCATG
CCGCTGCTAACGGCATCGCATCGAGGACTTGCTCGCAGAATGCGAGTCCCACGCAGTCCCACACGATTTCTCCTCCCGCTCCACCTGACGTGACTGGTGC
CGTCGCGTCTCCCGTCGCCAACTTCGCTCCCAAGGAAGCTGCTTCACCGATCACTTCAGCTGCCGTGTCCGACTTCGTGCTCCATCACCAAGCTGTCACG
GGCTTTGTACGCGACGCGCTGCAAGCAGCCGTGGATAAGCAGAAAGAGAATGCGGACAAACGGGGTCGGAAGAACACTGCTGTCTTCCGACGAGGCGANC
GACCACGATGCGCCTTCACCCGACGTTCTACGTCGGGCGCCTCAAGCCGTATCATCCGGCGGGCATCCCCGACCTCCGTTCGCGTCCTCGCGAGCGGGCG
CGTAATCCGAGACCccttgacgacgtcgctgacgACGGACCACACGTGTCGTCATCTCaccctgctgcagcgcctcgaacgcAGCAGTCTCCAAACGCCT
CAGCCGCTCCACGAGACTCCGCTGCTCGCGACGCGTTctctcggctgctgctgtcgccgcggTCGCGTCCTCGCGAGCACCCCCTGCGCGTCGTACACGT
GATTCGACAtctgctccgcctccgcgCGCATCAAGCGATACTGGTCCAGCGTCAGCCGCTCCGAGCGGCGCTGCCCCTCGGGGCCACGAGGTGCCTCGAC
AACCATCGATTCAGGCGCCCTTTCGTCGCGACGGTCCACCCCCGCTGTTTGACGCGTCGGGCGCTCGGCGTTGGATTGCCGAGCGCATTGTTGATCACGA
TACGCGTATGCCGCGCGCAACTGGTACTGCGTCGGCGCCACAGCGGGCTCGTGCTGAAAAGCACTACCGTGTCCGCTGGCTGAGATACTCGCCAGCGGAG
GATACGTGGGAACCCCGTACGCGTTTGATCGAAGATATtccggacgtggtggtggagtACGAGGCCTCGCTtacggcggcgacagcgcgcgttgctggtg
ctccCGTCCACAATCTCGcgagcgccgacgctcgCGACCACCACAACTGTGACtccgagaacgacgaccGCGAGAATGACTACGACTCCGAGAGCGGCGC
CGGCTCCGAGCACGCCCTGGGCTTCGAGATCTCCGCGGACGGCCACGGCCTGTACACCCGCGACTACGATCACGACTGCGCGACCGCTCGCGACCGCGGC
GAAGGTCCGTCCGCCGAAGCTCCGAGAGCGACCGCTCGTAGCGTCCGATCCAGCGACGCTCGTCCTCTCTCAGCGTCTAGACCCGAACTTGATCGTTCCA
CTCGGCTTGCGTGGGCCGCGGCTGATGAGCCGCGGCGCAGTTCGAACAGCCCTCTTGGAGATGGACGTAGCA