Description :
From Genome Similarity Track
Location :
Scaffold_1188:60- 1519
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_1188-snap-gene-0.3Amino Acid/Auxin Permease (AAAP) Family

Sequence
1459 bases(100 bases per row)
GCAGCAGACAGGTACTGATCTGCGCGATGACAGTCAGCCAGCGGCCAGTCGTTCCCATGCACCACTCGCCCATGTCACCGTAGGTCTTGACAGACTTGGG
GGCCATCAGCATCGTCTTGGAGATGCACCAACCAGCGTAGACGTTGGCGAAGGCCATGAAGAGAAGAGCGACCGTGGCGATCGCAGGTCCGGCGCGCGAG
AAGTTGCCGGGCATACCGAGAGTACCAATGCCATAGACACAACAGAAAATGCTGAAGGCGGCCTTGAGGTCGTCGACCATGATCCAGCGACGTCCTTCCT
TGCCCATGGTGGATGAGTTTCGCGCTCGCGGCGGGGTCGAGCTGGAGAGCGGGTCCTTCCGGGAGTGGAGACTTGAGCCGAAGACGGCAGATTGGAAAGT
GAGGCGAGCGGTGAGGCGCGAGCACCGCGAGCGACCCGACTCGGATTTTGCGAGACCGGACCCACCTGCCGACAAGAGCGTACACTTGACAGCTGCAGCC
CTCGACGACACACCTGCAGAGAAACCTCAGCATATGGATACGGTACAGAGCGAGGAGCTGCGCATCCTCGCTGTCACTCGGCGCAGTATGGTTCTCCCAT
GAGGGGGTTTTAGACAGTCGGTCCCGCCGCTCTCACGTTCTTGCCTTGTCTCTATTCCGTGCACAGGTATCAAACACCAGCAGAGTCTGGTGTTGGAGGC
CGAGGAGAGTGGCACTGGCTTCTAGCATGCATGCACCTATTGTTAACCCATACAAACACCAAGTCAAATAGAATGCGCAACAGACGCCAAGCCCTGTCTA
TCGCCAACGGTAGCGAAGTGCAGGGCCGCCGAGATACGGAGCCGGCCAACTGAGATGATCTGTGGCGCTTCGCCCAATCGGAGCGCCGGGTCGCCGTGAC
TGAGGCTCGGTCACTGCGAATCGTCGCCGACGAGCTGGCTTTGGTCGCCAAGGAGGAGCCCAAAGCTGCATCCAAACGATCGATTGGACGGTCACATGCG
CATCGCTTGACACCTCGCAGCTCCCACCGAAGGACGCGGCAATTTCGCGCCTCCCTCGGGTCGCCGCCACATGTCATGCGACGAGCGACATTGTGAGCGA
TCGGTTTCTCATTATAGGCATTTAGCTAAACACGGATTAATTGCCGCGCGTATGACGGCGAGCATATGTAGTGTGCACGTCGTGCGCCAAGTGGATAGTT
TGGGTGCGGCGTTCACAGCAGCGACAATCCAGGTGACAGCGAGCCCTCTGGGGATGCGCCTCGGGGTACAACAACTTCAGCTCTTTGTGCTCTGTTCGCC
TCAAGGACCGGGAAGAAATCGAATTAGGAAGGATTACGTTACAATGGAACAACTTCCGCAAATCGGGCCTCGGCTGACGTTCTCCGAGCAAAGCGGGTTG
AGCTCTTCGGCCAGGTCACGTTCAAGCCAACAGGCTGCCAGAAACCAGTTGCTTTGCGG