Description :
From Genome Similarity Track
Location :
Scaffold_931:60- 1492
Sequence
1432 bases(100 bases per row)
CTAGCTCTGGCTTACACGTATTCCCGGTAAACAGGTCCACTCCAAATCAACAATTTTGTTGTTTCCTTGGATCGACTTGGGCAACGAGGGGATATGATTC
ATGGCTATGATTTGGGAAAGGGTAAGTCGCTTGGATATTCCCAGGTGACTCCCCTTCGATTGTGGGCCTGCCCTTGCCTGTCTCACAATCCACGCATTCA
CCGACATATCGTTGTACGCTCTTGAAATAGTCCTCTCCAGTGGAAACATTCCCGGATCCGTTGGTAGGTCCGACCAATACCCTGATGTCCGCCTTCCAGG
CTAGCATGGTAGTGGTGTAGGACATCCTGTTGCAAGGTTTCTGGCATCACCAGTCTCATCAATCCATCCCGATCCTCGTTAACTCTCTTCGTAGGGGGGC
AATAGAAGAGCAAGTCATTCAGATCCACTGCGTAATCCGTAGCGATAATACTGTAGGATTTAGTATCCTCCCGACTCAGGTCTCGTACATCCCCCATCAG
ATACTTCTTTAGTCCCACGATCCACGCTTCCTCGTTTTGTGCTTTGAGGATCCGCTCAATACGGACTCCCTTCACAAATGTTTCCTCGAGGATCTGGGGG
CTGGATCCAATCCTTCCTCTGGACCTAGTGACGGCCATCACCTGGACTGTTCTTTTCCTGGATCCAACTACCACCACTTCGTCTAGTCGGTTCAATGTAA
CGAGATCCTGATGCCCGGCTTTTCTCTCCACTTCGACACCACATTGATTTCGTAAAGCGGCACTGGCCAAGCTGTCTGCACTGGCATTCCAATCTCGCTT
GACATGCACCAACTCGTGATTCAACCATCCACGCAGGTGGATCATCACTTTCTGCCGTAACAGTGTTAGGGCCGGGGCCTTGCAGTCAATCTCGCCTCGC
ACCTGTCTGATTACCAAATTTGAATCTCCACAAATCACCAGCCTTTTTGGATCGTGTCCCTTTAGTAAATCCAAACCCAGAAGGAGTCCGTTATACTCCG
CCTCATTGACGGTGAGGCCTTCTGCGTAAGTGGATCTGGCTCGTACAACTTCCCATTCGGGCAGTCTCCACAGTATTGCACTGTATGCTCCTCCTCCGCG
TCGTACACGAGCGGATCCATCGAAACTCAGGACGTATAGATCCTCATCCACCTGTACCGTCGGGATCGGGATCTGGATCCGGCGTTGGGGCTCTTTCTTA
GGGGCGATCTTAGTCAGCGCCTCATCCATCTTAGCTCGAGGAGTGATGCTCGCGGCCAAGACTCCCAGGATCTCGTCTTCCCCTTTCGAACATTTCACAA
TTTCCAGCGTCCAAGGTGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGCAACCCGGCCGACTTGAACAGCCAGGCAGATCTAGCAGAGCATCTGCA
GCGGGCAGAGTGTCAAGGCTGATATCGTCTTC