Description :
From Genome Similarity Track
Location :
Scaffold_5305:60- 1205
Sequence
1145 bases(100 bases per row)
CCAGGAGACTGAAGTTGAACCCGAAGTCCTCGAGTTTCTTGGACTCAAAGTGCCTTCAACCCTGGACCCACCTCCAGGTAGCTCGGAGATTCCCCAGGTT
CCTGAAGCCTCCCAGACTGTGTTTGAAGTCGGTCGGATCGCCTCGAAGAGTATGAACCCTGTTCTGCGTCGGAGCTCCTACATCGACGACATTTCTTACG
GCGCCCCGAGTTGGAGCGAACTCTGCGAAACCTTGAACAACCTACTGTACCGTCTGAGATACTGGAGAATCTCCGTGAGTCTCCCTAAGAGCGTCTTTGG
GACCAAGTCGATCGAGTATCTGTCACATCAAGTGATCCGCGAAGGTATCGTCGCGAAATCGAAGCTTCTGAAAGGACTCAAGGATCTGAAGTTCCCGTCA
AGTCTCAAGGGTGTTCAGTCTTTCCTCGGCAGTCTGAACTACTACAACAAGTTCGTCGAGCACTTCTCAGTGATCGCGTCGGTGTTGTACGAACTCTCGG
ATGACCAGGTGCGAAAAGGCATCGACCTGGAGCGTGCTCGGTCTGCCTTTGACATCCTGAAGGACAAGATCACCCAAGCACCACTCCTGAGACACCCTGA
TCGATCTCGGCCCTTCTCGATCATCGTCTATGCGAACCCTTGGGCTGTGAGCGCCGTGCTCGGCCAAGAATATGATGGAGTCATCCACCCGGTGCGATTC
ACAGGGCGAATCCTACATGACGGCGAGTTGCGGTACCATGCCTCCGAGAAAGAAGTGCTCGCCCTCCTCCGGGTGTTGAATTCCTTCTACACGCTGGTTG
TTGGGCAACGCGTTCAAGTCTACACCAGGTACTCTGTCCTGAGATGGCTGATGAAGTCAAAGACCCTTCAGGGGCGATGCCTGCAGTGGGCCACTATGTT
GTCTCCCTGGGACCTCGAGGTCATCCAGGTTGAGAAGGACGAAGATGGCCTTGCCGCAATCCTCGCTGCAGGAATCACACCTCGAGAGAGAGTGGACGAA
GTAGTGTCCGAGCTTATTCCAAGAAAAGGCCTTCGAGTCAAGACGCCTCCGATCAGCCTCGAGATGTTGTCTGAGAACTATTCTGGACACCTCATGAGCT
TTGACGGAGCCGCCAAGCTCAAGACCCGAGAAGGAAGTGCCGGCT