Description :
From Genome Similarity Track
Location :
Scaffold_1118:6- 6803
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_1118-snap-gene-0.1Gene of unknown function
Pytve_DAOMBR484maker-pve_contig_1118-snap-gene-0.2Reverse transcriptase

Sequence
6797 bases(100 bases per row)
AATTTCGGACCTCGCTTCGCCACAATGGTGCGCATGCCCGGATCTTCGGATGAAGGCCAAGAGGTGAAGGTCAAGACTGAGCCCGGGGTTGATTTGACGT
CGGAACAAGATGGGCGCCCGACGTCATCTGCATTCGCTACAGCGACAGCGCCCGTTGAGCGACAGCCCCTGTGGGGGGCGGCTGCCGCAAAGATCGAGGA
GGCTATCGATGAATTTGAGAACAAACCTCCAGCCCCCCTGATGGCCCCTAACGGAGCCACTGCGGTTCGCGACGCGAGTTGTGAACCGCATGGCAGCGAA
ACGTCTGCGACAGCGGACAGTTTCCTGCCGACAAACCCGGCGACTAAACTGGCCGGGACAAAGAAAGTCGCGAAGAAGAAGAAAGCGCATGTGAAGATGA
AGGCCCCAAGAAGCGATCACGATAGATCCGCAAAAACCGTGCCTGATATTTCCGTCTTGAAGAGTGAATCGAGTCGCCTGGTCGGTGACCACTGGAACCT
CGATTTCGCTTTTCATCGCCGCGAGTTGTTCGAATTCATTGACCGAGACCCCGTGCTACATCTCATGCAGCTACGCCTGATCGGCGATCTCACGGGGCCG
ATATCTCGTCTCCCATCGATCCGAACGAAGCTCGAGGCCGCTAAGGGACTAATGACTCTGATGAAGGAAGTTGGTTTTGTCCCTGGACCGTTCGACCCCA
ACGAACTGTTCGAGTTCGAGTTCGACGAAATAGCGACGACACTAACAGAAGCTTGGAGTCTTCTCTCGACTCTCGTTGGGGTAGGTGACAAAAAATCAGC
TAGCCACGCACAACATCCAACATCTCGAGCGTCATCATCGGAGTCATCCAGCTACCAGACAGGAGCCTCAAGATCAGAGTCCGACACGGACCTCATTCCC
GGCACTCAACGTATGACAATCACACCGGATTCAACCCGACACTTGCTGCCAAAGAACGCAAATGCAAGTGTTCAGGTTCGACGGGGAACCACAACGCGAA
ATGTCCGCGAACGTGTTGCTCCCCGGAATACCGTTGCACGCAGCGGAGAGGTCACGGAGCAAACGATGGAAGAGATAATGCGAAGAGTACTCCAACATGT
CACTACGGGAGGTTTACAGGTTCCCTCGGCTTCGACACATGTAGCGCCTACGGGGCACTTGGATGCGGATCACGGTATATCGATGGATGTCGACATGGAG
TCTGTAGGTGGCGAATTTGATCCAGACGATCTCGATATCACCCCACAACGCATGATCGCGATGGCGACTTCGGCTCCCAACACACAACTAACTGCTGTAT
CGCGCGTTCGCATGTCTGCGATCTCAGACTTGAAGGAATTCTCTGGCAAAGATGTTGACGATGACCGTGCAAGATCCTGGTTGGGTAAAGTCAAGTCAGC
ATTTATGCGCGATCAGTCGAGCGACGAGGAGAAATGCCTAACTTTAGGGGGTCTTCTCACTGGTCCGGCGCGGAACTGGTACCGGCAGCTCAGTCGCACC
ACGCGAGGGTCGTGGGGCGACCTTATCGAACAGTTTCAAATCCAGTACTGCGAACTTGGAGTCTCGGCCTCTCGACAGTATCATCACGCGAAGAAACGTG
CGGATGAATCACCACTCGAGTACCTGTACCGACTCAACGTCGCGGGTATGCGAGCCAAGATCAAGATTAAGGATGGCCCGGCGACGAACCGCCGCGAACA
TGTGGAACATTTCATCGAGACGCTCGACGACCGAGACTTGGCCGATCAGCTAACGCCGCTACGCATTCAGGACGCAGACGATCTCGAGGATGTCCTTCGC
ACGTTGCAACGAGCCAAGGCTCGGCAGAAGAAAACACTCTACGGGTCGTCAAAATTCCGGCAGAGAGCAACTGTATCGCCCGCCCCTGCGGCCAATACTC
GTGCAGTTCGCGCGATCGCGAAAAGGACCTCCGAGGATGAGTACTCAAGCATGGATTCTGATGCTTCTGACGGTGGAAAGAACCTACGTCGGATCTATCT
CGCAGCCAAAGAATCCAGTCAGGAGGCTCGCGACAACGACCATGACCACAGAGGACTGCCCGATCGCATTCGGGAGCAGTCACCCCGCGATGGCGCTATG
CAAGATCGGAATGGCGAGAAAGGACTGTCCCGCTGCTCACATTGCGGATCACTCCGACACTCTGATTTAGGTTGCTGGCGTCGTCTGACGTGCCTGAAGT
GCGGCAAGAGAGGTCACCCATCAGACCGTTGTCTATTTGTTTGCCGTGGTTGCGGTGAGATGCACGACATCGGCAAGTGTCCAATGGAGGAGTTCTACAA
CCTGGTGCGACAATGGTACGACCCTTCCAAGCACGCTGGAATGCTCCCCGTCGATGCGGAGAAGATGTTAAACTAGATCGCTCGCTGGGTTGGAATCCTA
GACGGGCCGAGCGATCCGAAGTTTGCGTGTTTGCATTCGTGGAAAAGTCATTGACCAAGGAGAAAGAGAGGGAGTTAACAGCGCCTCCTTCCAATACATA
TGGTCTGCAAACGGGGACCTCTGCTGCTGTCTCTAGTCTCCGTACTATCGCTCCCGACGATGAATATGCTCGTACTGCGGTTTTAATGGCGATTCATTTG
CTCCCGGGCGAATCACGTGGGTATTGGAAACATCACGCGCCGGACAAGTGGTTCAAACAAGCCAAAGTCAGCGCAAAGATCAACAACGAGCGAGCTCTGA
TGCTCTTCGACAGTGGCGCCGAGGTGTCGATAATTGACACCACCTTTGCCCGTAAGGTAGGCTGCCAGATCGATGTGAGCCAGAGACAAGAGTGCGTTGG
GATTGGCGAGAGTACTTACCTGACGGATGGAAAGACGAGGATCAAGATTACGTTAGCCGGTTCGCTGGTGTATTACTTTGACGCATGGGCAGGTCGTCTC
TCGGGGCAGGATGCCATTCTCGGGATGGATTTCATGGTACCTGCCGGAGTTCGTCTCGACGTTGCCGATGGCTCGATTTGTTTGCCAGACGAAGTCCGCA
TTCGAATACAAGGACGTCGTCAGCTCTTCAGCGACCGCGCCCGTGTCGTCACAGCAGACCAACATATCGCGATCGCAGCTGGTGCGGTGGTCGATTTACC
TGTTCGCCACAATCCACGCGATAAACAAAAGATATGGGTGACGCGCGGAGACAATTGGGTACCAACCATTCTGAAGCCACCTGGATCAATGATTTACCTC
CGGATCACGAATATCTGTGGCCGTGAGTTGAGAATTGATAGGTTGGAGCGGCTCGCGATTTGGCTATCGGGAGATAATGTGCCCCGCACGCCTGGTTTCG
TGTCAGTGGGATCGCGGAGATATACTGAATGGCAGAATCTCGCTTACGAAGCAACTACTGAGAGATACACGAACCCTGACGACGACGGTGATGGCCAAAT
GTCCGGTCCGCTTGTACAGCGTCCTACTTACCTCGAACCTCGAACTATACTACGACGGGCGGTTCATACGGTTGACGCCGTGTCAAGACTGACCCCGGGC
ACTAGGGAGTCTGACGAGCAAGCGTCGTCCTTTACTGAAGCGTCAGACGAGATCCAAGGGACACCTCAAAATGTTGACGACACATCCTCGGTCAAATCGC
ATAACTCTTCCATCAAGACGGCGAAGGGTGATCCTACCGGAAAGTCGATTCGCGGACCGACTGAGAACGATGACACGCATCGAGATTCGAATTCCAGACA
GACACGCACTGGGGACATGCCCCACAGTGCGGAGGTGAGAGAGACGAATAATGGTGGTGACGAAGAGGTAACATGTATCCACGAAGGGGGCGAGTTGTTC
GCGGAAGATATCGAATCTCAGATGGCAGTCCTACCTGAAATCACACCAACAACCGAAGACGTGAAGATTGATGACCTGCAGGTCGGCGATCCAATGAAGA
ACTCGCCCGAAGAGATCAAGCGGCTCAAAAACTTGATCTGGCGATATAAGCACCTATTGATCGGGAAGGGAAATGCACTACCGCCTGCTGCTGTCGGTGC
CGTTTGCGACATCGATGTTGGAGACACCAAACCGATATCGCAACGAGTGAGGAAGATCCCTCCCCAGTTCCGCGAGAAAGTCGCCGATCTGCTGAAAGGT
CTATTAAGGGCCGGTATTATCCGAGTCTCGACGTCGCCTTGGGGATCGCCGATTGTCGTCGTGGTAAAGAAGAACGGAGTCGATATTCGCCTTTGTATCG
ATTACCGCTTGGTCAATGAGAGAACGCGACTGATGACCTACCCGATGCCACTAATCAACGACCTCCTAGAAGATCTCGACAAGGTGATGTGGTTCTGCTC
GCTAGATATGGCGAGCGGATTCTGGGTCGTGTCAATGACCGATCGAGCACGTGAAATCTCGGCATTCATAACGCCGTTCGGGCTGTATGAGTGGAACCGC
ATGCCATTTGGCTTAAAGAACGCACCACAGATTTACCAACGACTCCTAGACAACGCCCTGTACGGATTCTTGCAAATATCCCAGTCAAGACCCGCGGATA
ACAAAGGGAGCGACGTTAACTGTCAGAGTACCGAAGCGGAAAGCAGTGGCATCAAAGACAGCAACAACGGGTCGGATTTGCGCGTATTCCCCACGATATC
GAACAACCAGGTGTCCATGAGCAACTTCAGTCGTGGCAGCGACGAGGGAGACAGTGGCCGCAAAGGCGGTCACGACGACAATTACAGTGATCTTGACCAA
CAAGTTGACTTGTTTAATCTGGGAGAACCTGATGACAGCGGAAGGCCATCAGTACTGGGGCGTAGGTCTTACATTGACGACATTTTGGTGACAAGTCAAT
CCTGGGAAGGTCTGTGCGATCGCATCGAGCGGCTTCTACAAACCTGTGACCGGTGGAACCTGTCTATCAGCGTCGCAAAAAGCTACTGGGGCAAAGCGGA
AGTAGATTACCTTGGTCATCGTGTGTCATCCCGTGGCCTCGAAGCGCGACCAAAGGAGCTGGAACAGCTAAAACGCCTTCCTTTCCCGCGATCATTGCGA
GCCATGCAATCGTTTCTCGGCAGTCTGAACTACTACAATCGATTCATCGAAGATTTCGCAGTATACGCCACAGTTCTATACGAGCTTCGACACAGAGATT
TTGACGACGAGACAAATGAGGCAGTGGCGGAGGAAACGTCTAAATGGACGCGAGCGAGGAAAGCATTCGACATCCTCAAATCCAAGATCGTCAGTACACC
CATCTTGCGCCATTTCGATGTTACCAAACCGCCAATAATTGTGTTGTACGCAAGCGAATGGGCAATCTCAGCTGCGCTAATGCAAGAACACGACGGGGTG
TTCATGCCGATTAAGTTCTCCAGCCGAACGCTGAAGCCCAACGAGATCAACTACGCGATCGTCGAAAAGGAGGTGTTAGCTCTGCTTCGGATGCTCGACA
ATTGCTTTACAATGCTTGCAGGACGACCTCTACGCGTGCTTACACGACACTCAACGCTGGCGTGGCTGTTGCGGTCTAACGGGCTACAAGGACGTCTCTC
TCAGTGGGCTGCAATACTATCCCCGTGGACAATCGAGGTGACGAGAACGACGAAAGGCGAAGACGAACTGCTGGGGGCGATTGCTGCAAGCATCACGCCA
CGGGACAAAGTCGATGCCTCACTAACTACGATCGCCCCTCGCAAACAGCCGCTGCGATCAATTACGATCCCGATTCCAACTGTTGAGCCCAAAGAGAGGC
TCCTCGCCGTCAGTTTTGACGGTTCAGCCAAGGTAAAGCGTGGAGGTGGTGCGTTTAGCGCTATCGTATGGCAGTTGCCTGAGTGGAAGGTGGCCGCAGC
TGCATCTGGGTACACGCCCGATCTCACGGTAAATGAGGCCGAGTATCACGGGCTTCTTCTCGCCTTCGACCTGCTGTCCAATATGGACAGGGGGCGTCTC
ATTGTGTGTGGGGATTCCAATTTAGTGATTCGTCAGCTCCGGAACGAGATGGAGTGCAAAGCGTTGAATTTACAGCTGCTGCGTCAACAAGTCATCAACC
GATCGCGATCGTGGCCACACCTGGAATATCTACATGTGAAACGCGAATGGAATGGGAGTGCTGATCTGCTTGCTGGAATGGCTTTACAGCGTCAGAAGGG
AGTAATCGTCGAGTCGGAAACGGAGTACTCTAATCTAATGGAGCTCAATCGGCTGAAAGACATCCTGGTGCCGAAATCGCAGCTGAACACGTTCGCAATC
GCTGCAGTAAGCACGCGATCACGTGCCCAAAGTGGTCATCGAGCCGCCGTACAAGAAGGAGATGTTCAGAGTGTGAGACTTGGCCGGATCAAAGCAGCAC
AAGATGAGGAACAGTGGATCGCGAACTTAAAGTGTTATCTTCGCGGAGATTTTGGCGGACTGGGGCGATCAGAAGTTAAGGCATGTCGGGCGATCGCTTC
CCAATACGAATTGGACGAGAACGGAGTACTGTATTATTGCCCCTACAAAGCCAGCGATGAAGATGGCGAACGTGATGGACTGATGCGTTTAGTAGTGCCA
GAAACTCTTCATGCAGACGTGCTCCACCACTATCATGCAAGTGTTGAGGGTGGACATCAGGGTATCGGCAGAACGTACCTCCGTGTGCGGCGTCATTTTC
ACTGGCGAGGTCTCTATGCGAGTGTTCAGAAGTACGTGGGGGAATGTGTCGATTGCGAGACAGGAAAAGGCAGACCTACGATACGTGGCGAGTCGCCAGG
CAATCTACAAGCGACGTACCCATTTCAGATCGTATCCATGGATCATATACCCTCGCTTCCAGAATCGTATCGAGGCAATACGGAGTTACTGATCTGG