Description :
From Genome Similarity Track
Location :
Scaffold_557:6- 5272
Transcript NameFunction/comments
g13040.t1RAW24142.1 hypothetical protein PC110_g19429, partial [Phytophthora cactorum
g13041.t1hypothetical protein

Sequence
5266 bases(100 bases per row)
AACCGCTTGCTCAACGCGTGCTTGGTCGATTCCAACAGCTCGTCGTTGCTGCTAGCGAGGACCAAGTCGTCAACGTAGAGCGCCACGAAGATCATGTCTT
GGCCGTCACGCTTCAAGTAGATGCAGTGGTCGGACTCGCACTTCTTGAACCCCAGCTTGAGCATGAAGTCGTCGATGGTCTGGTTCCACATGCGCGGCGA
CTGCTTCAGTCCGTACAGCGACCGCTTGAGCTTGCATACGTGGTCCGGGTGGTCTTCGTCCATATAGCCATCCGGCTGTGCCATGTAGATGTCTTCGTCC
AGCACACCGTTGAGGAACGCCGTCTTGACATCCATCTGGTGCAGCTTGAGACCATACTTGGCAGCTAGACTCAGTACGATCCGGATGGACGTGAACTTGG
CCACTGGCGCGAAGGTCTCGTCGTAGTCGATGCCGTACTTCTGCGAAAACCCCTTGGCCACCAGTCGCGCCTTGAACCGCTCAATCTCTCCAGCTTGGTT
CTCCTTCACGCGAAACACCCATCTGCAGCCGATGGCCTTGCGTCCCTTCGGCAGTGGTACGACATCCCACGTGTCGTTCTTGAGCAGTGAGTCACACTCC
GAGTCGCACGCCTCCTTCCACTTGACTGCGTCGCTGGATTCCATCGCCGACTTGAACGTGGTCGGCATTTCTCCCACTGAATCCACGACGTACGTAGCTT
CGAAGTCTTGACTTTCTTGAGCCGCAGCAGACATCTCGTCCAGCGTCTGGTGTCGACTCTGCGACGCATACCGCTTGGCACTTGGAACCTCCGTGACTTC
CTCCAGCGACTGCGTCCGCGGGTGTCGCTTGTTGCCGGGCCCGACATCTTCGTCCCGCGCAGCTTCTTCCTCTTCCTCTTCTTCGTTGTCGTCTTCATCC
GACTGCGACGAATCTTGATCCGTCGTCTCTTCATCTTGAATGACCACCACCTCCCTCTGATGGTAGTCGCGTCTCCCACTGTCGAAGACGTCTTCCATGA
ACTGCGCGTCGCGGCTCACCAGCACGCGACTGCTCTCCAGTTCTTCGAATCGATACGCTTTCTCGTGCTCCGAGTATCCCAGGAACCGACAGCGCACCGA
CCGAGCGTCGAACTTGGTGCGCTTCGCCTTCGGCACGTGCACATACGCGTGGCAACCGAACACCTTGAGATTGGCCAGCAGTGGCTTCTTGCCAGTCCAG
ACTTGGTGCGGAGACTTGTCGTGGCTGACGGCGCGTGTCGGACACCGATTACGGAGGAACGTAGCCGTCATCACCGCTTCACCCCAATACGTCTTGGGCA
ACCCGGCATGTTCCAGCATGCAGCGCGCACACTCCACCAACGTCCGGTCCATCCGCTCGGCCACTCCGTTCAGCTGAGGCGTGTACGGCGGAGTGAACTT
CTGCACGATACCGCGGTCCGCACAGAACTTGGCCATCGCACCGGAGGTGTATTCGCCACCGTTGTCGCTCCGGAGTGTCTGCACGCGCTTGCCGGTCTGA
GTTTCAGCAAACGCCACAAACTCCGCGAACTTGGCAGCCACCTCGGACTTGTTCCTCAGCAAATACACCACGCAGAAGTGCGACTTGTCGTCGATGAACG
TGACGAAGTAGCGCTTGCCTCCAAACGTTGGTGTCTGCATGGGGCCGCACACATCGCTGTGAACCACCTCCAGTACTTGCTTCGCACGGTTCGGGGACGA
CTTCATGTAGCTCACTCGCGTTTGCTTGCCGAGTGCACACCCGTCGCACAGCTCCCACTGCTTCACCGACGTCATGTCGATGCCAACACCGTAGCTCTTC
TTGACGATGGCGTCTAGACCGCCATGGCCAATGTGACCAAGTCGGAGGTGCCAGAGGTACGACGTGGTGTCCCCTTGGCGATCCTTCGAACTTGCCGCAT
TGGCCTTGTCAGGCATCATCGGAGTCATGCACAGCTTGAACAGCCCTTTGCCCTCACGAGCGCCGAGCTGCCACTTGAGACCCTTGTTGTCCGCGAAGCA
CCCGTCGCTCTCGAAGGTCACTAGCCCGACGTCCTTGGTGAAGCGGCCGACCGAAAACAGGTTGCGCGACAGCTTCGGGATATGCCACACATTCGTGAGC
ACACCCTTCTTCATGCCGTGCGGCGTCTTCATCGACATGACAATGTCGCCGGTCCCCACCGCCTGAACCACACCGTCGTCCGCGAGATGCACGTCCACCG
GAGCCATCGTCTTGTAGTTCCTCATGTACTTGTTGGAACTCGTCATGTGCTGCGTCGCACCCGAGTCGACCAGCCACATGTCACTTGGCTTGGCGGCACT
GCTCGTACGACCAACCGAGAAAAGGTAGTCGCCAGGATCTTCTTCGTCCTGTGCGACGTTCGCACGCTGCGACCGATATCGCTCAGCGTCGTTGTGGAAC
CGCGAGGGACACTCCGCGATCCAATGTCCTTGTTTGCCGCAGTTGTGGCACGCCCCGGTCTTCTTCACCGGTCGGCCCTTGCGCTTGTTGTTGTCTCTCG
TCATGAACGCTTGACCTTGGCCGTGCGCGGCTCCGTCGACGCCGCCGCCACCTTGTTCCTTGCGCTTCATGTCCTCATGCAGCAGCCGAGACGTCACGAG
CTCCCACGACAGCGAGTCGGCTCTCGACTCCAACGACAGCGAGTCGGCTCTCGACTCCAACGCCGTGATCAGGAACTGGTACGACTCGCTCAGACTGCCC
AGAAGCGTGATCACCAAGTCGTCCTCGCTGACCGGAGCGCCAACCGCGTCGAGCTGCTCCGCCAGCGTCTTGAGCTTGTTGATGTGCTCCAGCACGTCAT
CACCTTCCTCCATCATCGTCGTGAAGAAACGCCGACGAAGAAAGAGCTTGTTGGCCAAACTCTTCTTCTCGAAGTGTCCTTCCAGTCTTGACCATGCATC
ATGCGCGTCCTTGGCCGAGCGAACCAGCGGCAGCTGCGGGTCCTCCATCGCGAGACAGATGATCGCCAGCGCCTTACGCGACTTCCTCTTGAACGTCGCT
TGATCCGCCGTGGTCGTGCAGTGCTCCAGCTTCACTTCCCCACTCGTCACTTCCCACAGTTCGCGCTACTCGAGCACCATCTGCATCTTGAACTTCCACG
TGTGGAAGTTGGTTCCGTTGAACTTGTTGATGCGGGCGGTCGTGGTCGGGGTGGCGTCCATGGCGAAGGCGTAGTCGGGGTCTTGGGCAGGGAAGACGGG
GTTTGGGCTCATAACCAAAAGGCTTTGGTCGGTTGATGGCAAAATGCAAAGTGATTGATTTAGGTCCTTAGTTCGCAAACTCCCTTGCTACCTCTAAGCC
TACTGGATTCTCTACTGGATACACTCTACTGGATTCCTTACCGGATACTGAGTTGCTTCAGCCAATCAGCGACTGCCACGTGGATGCCCATCTTGTACCC
ACAATCTTGTACCCACGTGTCCCGTAATCCCCGTAGCGTAAACAGCGTCCCATCATCAGTGTCCCGCGTCCCATCATCAGCGTCCCGTCAACACAGGAAT
GATTGCGGTCCCACTGAGTGAAGGTCATACCGGTATCCTACCGGTATACGGCAGCTGCCCGAGGCGCCTTCTTGACAATATGTACCCATGTCTATTGAAG
GTATGGAGGGTTACCGGTTTGGTATTGGTTGTTGACCGTGAACCGGTTAACCCGAACCGGTCCAATCCGAACCCACGCCGATTACGCCACCGACGATTAC
GCCACTGTCGATTACGCCACCTGTGGGTACAAGATTGTAGGTACAAGATGGGCTTCGACGTGGCGCTCTCTCATTGGCTGAAGTAACTCAGTATCCAGTA
AAGAATCAAGTAGTGTGTATCCAGTAGGTCTAGAGTAGCGAGAAGACTAGCGAGCTAAAGACCTCAATCAATCACTTTCGAATCTTCGTTCTACCCCTCA
AGTGGTTTCCAGTCTCCGCTCCGGTCTCGCCCAGAGTGCTGCCCTCCCTCCGCTCCGTCAAGCTTCACGGTGTCAAGATCCATACCTTCCATCAGGTTAT
GAGCCCAAGCACCATGTCCTCTGCCCACGACGCCTCCACCAAGGTCTCCATCGACAAGTTCAACGGAGACAACTACGCGACGTGGAACCGCTACATGCGT
GGCGTGTTCCTGACCAAGTCGGTGTGGCATGTCGTGAACCGAGAGACGACGCCGAGCTTCACGGACTCGCGGCCCAAGGACGAGTACGTCAAGTCGAGCA
ACATCGCGTTCGGACTGATGTTGCTCCACATGGACGCGGACTACCACCATGTGGTCGACGACTGCGAGGAAGCGTGGGTTGCGTGGACGCGCCTGAAGAC
GCTGTACGGTGGTTCGCAGAAGGCTGGTCGCATCTACCTGAAGCGCCAACTCTTCAGCATGGAGATGTCGGAAGGCGGGAACGTGTTGCATCACTGCAAC
GAGGTCCTCAACATCAGCGCCAAGCTCAGCAGCATCGGCGCCAAGATGGAGGACGAGGACGTGGCGATCTGCCTGTTGCGCAGTCTCCCCAAGAGCTACG
AGAACGTCGTGCTGAACTTGGAGATGAGCAGCGCTGAGCTCCGATCGCAAGACGTCGTGAAGGTGCTGACGAATGAGCACATCAAGCGGCAAGGCGAGAA
GACGGCGACGGTGAAGACGGAGGACGCGGCCAAGGCGTTCAACACCGACCGAGAGTCTCGCCAGTGCACGTACTGCGGGAAATTGGGGCACACGGTTGAC
AAGTGCTGGACCAAGCAGAAGGACGAGAATCGGGGCCCAAGACGCGGCGGCAATGGCAATGGCAATGGCCGTGGACGCGGGGCCAACAATGCCCAGTGGA
GGAACGACGACGCCAGCTACGACTACGGCTACGGCTATGATCGAGTGGCGTTCGCGGTCTCACTGGAGTGTGGCATTTCGACGGGCAAGGATATGCTCGG
CATGTGGGCGGTCGACAGCGGCGCAACGCACCACATCTGCAACGACAAGGCCAAGTTCGCCCATTTGATTGAGCGAAACGAGGGCGAACTTTCGGTGGCC
GACGGCAACAAGGCGGCCATCATGGGTGTGGGGACCATCGTGGAATGAGTGGTTCTGCCCAACGGCGACGAACGCGACATCGAGATCAAGAACGCGCTGT
ACGTGCCGAGCATGAGCAAGAATCTGCTCTCCGTGCCACAGATCAACAAGAGTGGTCTGTTCCAAGTCGTGTTCGACGGCACCCAGATGCGCGTTGCGCA
CAAGGCCTCTAAGCAAGTGGTGGCGGCGGCGAACCTCGTGGATGGCCTCTACTGACTCCAGACGCC