Description :
From Genome Similarity Track
Location :
Scaffold_363:6- 5254
Transcript NameFunction/comments
Physo_144978reverse transcriptase
Physo_144979hypothetical protein

Sequence
5248 bases(100 bases per row)
CCCTGTGTTGCCTTTGTAGGATGCCGGCAACGACGGAATATGGTCCATGGCAATGACCTGGAACGGGTACGTCGCGACGATGTTGCCCGGCAACTCGCCC
TGGATGGTCGGCCGACCCTTTCCGGTCTCGCAGTCGGTGCATTCGCCGACGTAGCGCTGGACGCTTCTGAAGATCCCTGGCCAATGGAAGTGGCGCCTTA
CGCGTTGGTACGTGCGGCCAATACCCTGGTGTCCGCCTTCCAGGCTCGCGTGACAGTGGTGGAGTACATCTTCCCGAAGAGTCTCTAGGATCACCAGCTT
CATCATCACATCGCGATCCTCGGCGGAATCGTCGCTTCTCGGCTGGTAGTAGAGCAGCCCGCCTTCGCCCTCTTCGTACTGAGGCGCAAGCTTTTGGCAG
TTCTTCACCTCGCGCCGAGATAGGTCTCCGACGTCGCCGCGGAGATACTTATTGAGGTTGACGATCCAGACCTCTTCGTCCTGGGCGACACGGATGCAGT
CCAGGCGCAGTCGTTGCACCACCAGCTCCTCCAGGACTTCTGGAGGTCGGACCCTACGTTTTGTCGTGCGTGCGGCAGCCGAGCGCGTCGTCACAGCGCG
GACTTGTGCTGTCCCGCGTCCCGCGTCCATGGCCTTCCCGGCGGGGTCATTTGCGCCGCGCGTTTTCGCGTCGCGATTTTCCGAGTCCAGGTTTTCTGCG
TCGAGATTATCCGCGTCGGGACTCGCTGGAGACGCCATCCCGGGACTCGATGCCCGTGGTCGGATGAGTTCTTCCAAGCGATTCAGCGTCTTCAGATCTT
GAATCTCTTCGGGGCTGTGCGCGTTGTGGCCTCCTTGACGCTGCAGAGCATGTCCAGCTAGCATGTCGGCACTCGCGTTCCAGTCTCGTCCTACGTGGAA
GAGTTCGTGGCGCGGCCATGCCTGGAGTGCGTTTCGCGTCTTTTGTCGCAGCAGCTTCAGCCCCGGGAACTTGCAGTCCATCTCGTCCCGCATCTGCCTG
ATGACAAGGTTGGAGTCTCCGCATACGACGAGTCGGGTGACGTCGTCGAGCTCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNAGGCCGAACGGCATACGCAGACATTCGTACAGTCCCATCGGCGTGATGAAGGCTGAGGTGAGCCGGGCCCGGTCTGTCATGGGGACGAC
CCAGAAGCCGCTCGCCATGTCGATGGAGCAGTACCACAGATACTTGTCCAAGTCTTCGAGCAAGTCGTTGACGAGCGGCATGAGGTAAATCATCAACTGT
GTCAGCCCGTTGATGAGCCTGTAGTCAATGCAAAGCCGGATATCGACGCCGTTCTTCTTTATGATCACGACAATGGGCGACGCCCACGGCGACTTCGACT
TCTGGATCATCTTCGCGCTCAGCAGCCCTTTGATCAAGCCGGCGACCTTCTCTCGAAACTGCGGCGGGATTTTCCGGACGCGTTGCGCGACGGGTTTTGC
GTCGCCCACGTCGATGTCACAGACAACACCCAGGGCGGCCGGCGGCAAGGCGTTGCCTTTGCCGATCAACCACTTCCGTCGCTTCCAGATGATTTGGCGT
AGCCGCGTTTCTTGTCTCGCGGCTTCCTCGGGCGGGAGTCCAGTCGGCATGCCGACCTTCAAGTCCTCGTTCTTCACCTCGGCGGTCAGCGAGAGGTCTG
GCAGCACTGCCATCTCAGACTCGAGATCCTCTACGAAGAGGTCGGACCCCTCGTGGATGAGGACTGCGTCGTCTTCCTCCTGCTCATCAGGTTTCGCCTC
GCCGAAATTCGGCTCGGCGGGGTTTGGTCCGTCGAGTTTTGGCTCGGCGAGTTCCGACTCCGGCGATTCTTCCATCGCAGCGCTTCCAGCCACAGTCGGA
GGCATATCGGGTTCGCTTTCCACCGCCTCCTCGTCCGTATCCGGCTTGTGGTCGTCGGGTGGCAAGTCTACCCCCCTTCCCTTCAGCGCTTCCGCGACAG
CCGCCAACACTGGGGCCACGGCGCGTCGCGTTCCGAGTTGTCTCGGCTCCGGGCGCAAGATGGCTTAGGCGTCGGGTATGAGGGGCGATCCGTCATCGAT
CCGTCGAGCTCGGCTGGGATCCAGTTCTCCTCCGCGTCGCGCGTCGCGCCGTACGCCAGATTCTGCCACTGCTGGTACCGGGTGGAGCCCAGTCGGACGA
ATCCACGGTTCCGAGGCTGGCCGTCAGACGGCGTCCACCACCCAAGCGTTTCATGCGCGTCGAGGGTTATCGCTGCGTCTCCGATGTTCGTGACACGCAG
GTACGTTTTCTTTCCGACTCTCCCCTTGACAAAGGTAGTCACCCACGACTCTGCCCGTGTCACCCACAGGAACAGCGCATTTCGATCCGGCCTCAGCAAG
ACTTCATGCGTGTCTCGTGGTTCGAGCCTCACAGGCGTCTAGACGTTGATCGGGTGCATCCGTGCGCCGTATAGCGGTCTTCGTCCGATCATCTGGATAT
GCACCTCATCGGGGAGGCACGCCGTGCCATCCGCAGTGTCGATGCGCACTCCAGCGGGCACCATGAAGTTCATTCCCAGGATTGCGTGTTGGCCGACCAA
GTCGCCGACCCACAGGTGCATGTAGTACACCAAGTTCCCAGCCAAGGTAATCTTGACTCTGGTTCTCCCCACCGTGTAATATGTCTCATCACGAATTCCC
ACACACTCTTGCGTGATCTCCGTGTCAATCAGGCAGCCTACCTCACAAGCAAAGGTGGTGTCCAGGATGGACACCTCGGCACCTGTGTCGAGCAATAACA
CAGCACGGCAGTTGTTCAGCTTTCCATGAATCTTGGCCTGCTTGTACCACTTGTGCGGCGCGTAATGTTTCCAGTATCCGCGTCGCTCTCCTGGTTGCAA
GTCGATCTCGTCCAGGGGTGGTTCACGTGCAAACTCGTCGTCCGTCGTACGTCGGACCGCCGAGATTCGCGGCGCGCGTTCTTGCGTGGTACGTTCCGGG
TTGGATTCACATGTATTATCATTCAGGGAAGTCGGGCTCTCACTAACCACCTCTCGCGACTTCTTGGTCACATATGCATAGACGGAAACAGGTCGCTCGT
CTCGTACTGGTTCCCAAGCCAGCGAGCGTCCTAGTTTAACATCTTCTCGGGGGTCGGCGGCAGCATTACCGCGTGTTTATTCGGGTCAAACCACTGGCGC
AATTGGTTGAAGAACTCCTCCATCGGGCATTCTCCGGCTTAGTGCACGTCACCGCAGGCCTTGAACACCCTCAAGCATCGCTCCGTCGGGTGCTGGCCAC
CACACTTCTGACACGTCAACAACTTCCAGCAGTCTCCTTCGGCGTGGCGACGTGAACCACAGTGGCGACACCGCGGGCGGTCGCGTCCCGAGTCGTCGGG
ATCGAAGTTGCGACGCGCCGGCTCTCCCGGCGGGGCCTGTCCCGCGACGAACAACTTGGCGCGTTCTTCGTCCGCCTCGTCTTGGTCGTACTGGCGATCG
TCGCTGTCGCAACTTTCGCGTTCCGAGTCGTACTCGTCCGACGCGACGTGAATCGTATGCACGGCGCGCGCCGGCTGAGTCGGCGGGGTCGGCGCCTTTT
GGCGGAACTTGTTTGAGCCGAAGAGAGTCTTTTTCTGGTGAACCAATCGACGTTGTCGGGCACGCAGCTTCTTCTCCAGCGCCTCGGAGTCGGCGACCTC
CATCAGCGTGAGACGCGAGGCGAGTTCGGCCTCCTGCGTGTTCAGCGTCCGGATGAAATGCTCGACGTGTTCGCGCTTCTCTTCAGTCGTGCCCTCGGCG
TATGGGGTGTTGGCCCTCATGCCCGCGACGTTGAGCCGGTACAAGTAATCCAGAGGGGTCTCGTCGGGGCGCTGAGCCGCATGGTAGTAGCGACTGGCCA
TTGACACGCCCTTGCCGCAGTACTGCACCCGGAATTGCTCCATCAGCTCGGTCCATGATTTCTTGACCTTCCTGGGCAACTGGAGATACCATTGGCGCGC
AGGACCGCTCATTAGATCGCTGAACTGCCCGCACACTTCTTCGCCCGTCATCCCGTCGCGCCGCGCGGCGGACTTCAGACGGTTGAGCCACAGTCTGGCT
TTCTCTTCGCTGGCGTCCCGTCCCGAGAACTCTTTCAGTTCGGAAGATGCTGAGAGGCGTACGCGGGCGAGGGCTACGCCGCCGGCTGTCGCCGTCGAGA
CGGCGGCCGCGGTTCTTGGCACTCCGATGTCCAAGTCGAACAGGTCAT