Description :
From Genome Similarity Track
Location :
scaffold_1114:6- 4691
Transcript NameFunction/comments
g11015.t1 hypothetical protein PHYSODRAFT_252750
g11016.t1 reverse transcriptase

Sequence
4685 bases(100 bases per row)
ACAAGTCCGTACAATAACTAGTTACGGACTCCAAGAGTCTATTAATCCCTTAAACAAGGAAACTAACTCTTCAGAGGCTAAATCTCAACTGTATTATCTC
TTCTTATTTGTCCTAAACCTAACATACTAAATCCTTATCTAAATGCAACGTGTGGCTCTGAGGCCATCTACGTATCTACTTAGTGTGTGACACACCTCTT
ATGTATCCAACATCAAATGTATCCATGTGTGACACACACACCAACGTGTAACCCCATTACACTCTCCCCCACCAAGCTGTGGATACGGGGTATCCACACT
TCACTTTGTCCTCCGTTGAGGTATCGTTCCAACGAACGTGGTGGCTTCACATCACGTGGGCTTGAGAACATTAAAGCTCGCTGAGCTTGTTCTCCAACAC
ACTCCGTGAGTGGATCCCTGTATGGCCCCTGGCCACAAAGCGACTTGGTCCTTCGACCGACAACGGCAGACGGCTTCCTCGCCCAGTGAGTCAAGACTCT
CAACAGCACCTAGTGCTTCCCCGGCCGACGGCCCCTGTAGAGACTCTGCGGCGAGTTCATCCTTGGCTAAAGCCACCCTCTCGGTCACTGAGTATCACGC
GGAACACCGCCGCCAACATCGTCACCTCCATATGAAGTCGCATAGCGAAGGGAGCCAAGAGGCCACGCCTCCGTCAAGCCCGTCCCGGGCACGCGATCAT
CTCTTCGATGAATACGAAGAGGGAGAGCTCGACTACGAGTCTGACGTCAAGGAGTCTCATCGAGACGAAGAGGAGAAGTCGCTACTTCCTTCTTCTCCTC
GACGCGCTATGCGCACGCCCAATCCGTTCCCTGAACGCCGCATGGGCCTCTCGGCCGCAGGAGCTCTAAGTGAGCCACGGTATTCGTCACAGCGTAATGC
CCGCGGACTCGTAGAGTCTGGTATGGTCACCAATCGTCTCGATGAGGCTCAAGACCGTCTGGTCAATGAAGGAGCGAGCACTGTGCGCTCGCAGCGCCCC
GTGGCGCGACCTCTTCTCCCTGCTCGCCGAGAGTATGGCTATGAGCCTCGCGATCCGAATGAGGCGGCTCGCCATACTGCATCGCTGCCCTTAGACGTCC
ACATGGTGGGGCCCGAGGCTCGGACGCAAGACGAGCAAGCGACTCGAGCTGTGCTCCGGGATCGATTCCTGACGCCCCAGGCGACGACTCCTATGGAGTA
TCGTGAGAGACTTCGTCTCCAGTCTCAACGAGGCTCTGTACCGCAGATGCGGACTTATTCTCTCGTCCTCTATCCAGGCGAGACGGAGGAAGTCAATGAG
ACTCAGTTTGAGCAGTGGGTAGAGCGCTCACGGCGACTACCCTCGCTCTACGCCTTGAAGGCCAGCTTCTCGGAGCTCGACGCTCGCTTGGAGCGAAAAC
TCCGCTTCGAGTATGCCAAGCTGAAGGCGAAGCGTCAGCTACCCCCTGGGTTCCGCGCCCGACCCCTTGGGTCCGTTCACCATGCACCCTTGAGCCCTTC
GAACCACGAGCGCGGAGTGACAGCCGCCACGGCTGCCGTGGGCCAACACCGTACGCCTGGTGTTAGCCCAGGTGCCCCCCGACCTATTGTCGGGAAGCGC
GAGGTGACCGACGAGTCGGTCGCGAGCCCTGCGGGCGCCTATGATCGTTCCGATCAAAAGCGTCCACGACGTCAGGGCAGTCTTGCCTCAGTGGCACCTC
AAACTCCCATGAGTTCTCAGAGTGAGGGGAGCCACGCCACTTTACCAGATACTGGTTATGCCCCTGACGACGACGTCGGGCGAGAATCCGTTCCACATGA
TAGTGGTGATTCCCATGCTCATCGATCAAAGCAGGAGTAGGACGATGACGACCTAGATCCTCCTTCGGAGTGGGTAGAGCCGATGAGGCATCTCCGTCAA
GGCGTGGAGCGTATACAAGTTGATCACCGCCATGCGGCTGGCCAGATTGGCCGGATCTTCGGTGAGATCGATCGTGTGGAGCAGCGCCTCGACTGGTGGA
CGCTCCCACGGGAGGTCTCGGACCAGATTGAGCAGAATGCTCAGCGCTTACAAGCGGCGGAGACGGCTGCTGCCACTCTCGAGTCACGTGTGACTCACCT
GGAAGGCGTCGAGACTCGTCTCCAACCCGCGGAGCGGGCGATCTTGGAACTACGAGCCCAGCTCGATCTTCTTGTGCGCCTCCAGATCCACGCTCCCCCT
CCGGGCCCTTGGCCTTGCGCGGAGCCAGCGCCGACGCGCTCACCTGAGCTGGGTCCCGATAAGGCTTAAGCAAGCCCACGTAGAACACCGGGTGTGTTCG
CATCCTCTTTGGGAGGTCAAGCGTGTACGCAAGGCCCTTCTTGGCCACGACCTTAAACGGTCCAATGAAGCGAGGACGCAACTTGGTCTTAAAGACCGCT
GACACTGCATGCGTAGGTAGGTTCTTAGCGTTTAATAAAACCAGGTCCCCGACCTCATAATTTTCAACATTGCCTCTGCCTTTAGCATCAGCATGTTCCT
TTTGTTTGTCTTGGCTCTCAGCCATAGCGTCACGTACATGTCGAAGGACACTCAGACGCGTGGACAAGTAGTCATCCACCTGTTTACGAACAGTGAGAGG
GCTGACATCAGCAAGCCGCTCGGCTATCTCTCCCCCCTCAAGCCCTGAACCACGTGGTGGTGGCGTGAAAGGAACACGCGGGTTTGTCAAACCATTGACG
TAGAACGGCGTGAAGCCTGTGGAGGCATGCACCGCGTTATTCAACGCAAATTCCACAAAGGGCAGCATAGCGCTCCAACGCTTCGGCGTTTCTGCGCAAA
TGCTCCGGAGGATGTCCTCCACAACGCGATTCACGCGTTCCGTCTGACCTTCGGTCTGCGGATGGTCCGTCGTGGACATGTCCAGCTTGGTGCCAAGCAC
CTCGAACACTGAGGACCAGAACTTGCCCGTGAAGCGGGGGTCTCGATCCGAGACAATCGACTCAGGGAGTCCATGTTGCCGGAAGACACGGTCCATAAAG
ACTGTCACAGTCGCTTTACCATCGATGGTATCCGGCACCGCCGCCATGTGAGCCATCTTGCTCAGCCGGTCAACAAAGAACACTACACCCGTGTTGCCAT
CCGAGTCCTTCGGAAGGCCAAACACGAAGTTCATGCTCATGGATTCCCACAGTCCCGAGGGCACAGGCAGACTCGCCAGTGGCGCCGCCGCATGCGGGGA
TGGCTTCACCCGCTGACACGTCTCACACGTGCGCACGTGTGTGCTCGCCCACTTATACATCTTGGGCCACCAGTAGTGAGTGCTCACGGAGCTGTAGGTC
TTTTCCCGACCAAGGTGCCCGCCGAAAGGCGTGTCGTGAGCCTCATAGAGGATACGGTACTTCAGATCCTCATCATGAGGCACCACTACTCGTGGAGGAT
CCTCAGGATCGGTACTGTAGTACAACAGGCCCCACCATCGAGCGAATATCGATGCAGCCTCGCGCCGACAGTTTTCTGTCCGGGTTCTCAAACTCCTTGT
TTCCCAGGGCACGTAGCACAGTTACACACGAATCGTCGTTAGCATACGCCTCGCGTATCTGATCCGTCAACGACGACGTCACCATCGTGATATGAGCGAG
CTCATAGTCTGGCCGGCGCGATAGCGCATCGGCTAGGGCATTCTGCCGGCCCGGCTTGTACTTCACCTCGAAGTTATACTCCGCAAAGAAGGAGAGCCAT
CGGGCCATCCTCTGTGAGAGGTGAGGCGACTGCGTCGCAGTGCGTAGCGACGCATGATCTGTGTAGATCACGAAGGGCTTGGAGCCGAGCAGGTGGACCC
TGAACTTGACGAGAGCATACTTCATTGCAAGTAGCTCCTTGTCGTGAACTGGATAGTTCTTCTCAGCAGCCTTGAGCTGTCGAGACTCAAACGCGATCAC
GCGTTCATGCCCGTCGGCATCTTCCTGTAACAGGGCACTGCCGATGGCAAAGTCCGACGCGTCACAGACGACACTGAAAGGACGATCAGGGTCTGGCAAG
GCCAGTATAGGGGCATGAAGGAGGCTCTCCTTAACCGCCTCGAAGGCGTCGTGCTCACGAGAGCCCCAGCACCACTCAACATCCTTCTTAAGGAGATTCG
ACAATGGCCTAGCCATCTCCGCATAGTTGGCGCTGTACTTGTGCAAGTAGTTGGCTAAGCCCAACCACTTCCTTAAGTCCTTCTGCGTCATCGGAACCGG
CCAATCCACAATGGCCTTGACCTTGGCGGGGTCCGCCCTAAGGCCACGCTTTCCCGTGAAGCACCCTAAGAAGGGAATGTCTTCTGCTCCGAAGATGCAC
TTGTCTGCGTTAGCATACAGCTTGTTCGTGCGCATGCACTCAAGCACCGCTCGCAAGTGGTCAACGTGGTTCTCCACATCCGACCGACCGTGCTCCGCAC
GACTGTGGACGAAGATATCGTCAAAGTACGTCTGTGCGTACGCCCGGTGGGGCCTGAACAACTGCGTCACGAGACGATTGAACGTCGCTGGTGCGTTCGA
TGGCCCTTGGGGCATCACTAGCCACTCCCAGAGCATACCGCTCGGAGTACTAACCGCCGTCAGCGGTATATCTTGTACTCGCATGAGCAACTGATAGTAT
CCATCGACCAAGTCGAGGGCACTGCACATCGTACAGCCCACCATGTTGTTCTGAAGAACATCCTTCCGAGGAATCGGCGTCTGCG