Description :
From Genome Similarity Track
Location :
Scaffold_1321:6- 4677
Sequence
4671 bases(100 bases per row)
AAAGTCCATATTCCATGATGCACAGCATTCTTGGGGGACAGGCAAACTCGCCAATGGCGCTGCCGTGCTCGGCGCGGACTCTGTCCGTTGACACGTCTCA
CACGTGCGTACATAGGTGCCGACCCACTTATACATCTTGGGCCACCAGTACATCGAGCTCACCGAGCCATAGGTCTTCTCCCGACCTAAGTGCCCGCCCA
CGGGCGTATCATGAACCTCATAGAGGATTCGATACTTTAGATCCTCATCACGAGGAACGACTACACGAGGGTTATCCTCAGCGTCGGTGCTGTAGTACAG
CAGGCCGCCATCGAGTGAGTATCGATGCAGCCTCGCGCGTAAGCGCCCAGACAATTCCTTGTCCGAGTCTTTAAACTCTTCGCTCCCAAGAGCCCGTAGC
AGCGCTACGCACATGTCGTCTTGTGCATACGCTCCGCGTATCAAGTCAGGCACTGACGACGTCACTGTCGTGGCATGAGCTAACTCATAGTCCGGCCTGC
GCGAGAGCGCATCGGCCACTACATTAAGCCGCCCCGGCTTGTACTTCACCTCGAAGTTATACTCGGCAAAGAAGGAAAGCCATCTTGCCATTCTCTGAGA
GAGATGAGGCGACTGTGTCGCAGTGCGTAACGACGCATGATCAGTAAAGATCACAAAAGGCTTAGAGCCTAGCAGGTGTACCCTGAATTTGACTAGAGCA
TACTTCATTGCAAGTAGCTCTTTGTCATGAACTGGATAGTTCTTCTCTGCAGCTTTGAGCTGGCGAGACTCAAACGCGATCACGCGTTCACGCCCTTCGG
CGTCTGCTTGTAGTAAAGCACAACCGATTGCAAAATCGGAGGCGTCACAGACGACGCTAAACGGACTATCCGGGTCCGGTAGCGCAAGGATCGGAGCCTG
GAGGAGGCTCTCCTTCACAGCCTCAAAGGCTCCGTCGTGCTCGACGTTCCAGCACCATGGTGCGTCCTTCTTAAGGAGATCTGATAATGGCCGAGCCATC
TCCGCGTAGTTCGCACTGTACTTGTGCAAGTAATTGGCTAAGCCTAGCCACTTGCGTAAGTCTTTTTGGTTCTTGGGAACCGGCCAGTCCACGATGGCCT
TGACTTTGGCAGGATCTGCCCGTAAGCCACGCTTCCCAATGAAGCACCCGAGGAAAGGTATCTCCTCCGCGCCAAAGACGCACTTGTCCAAGTTGGCATA
CAACTTATTAGTGCGCATGCACTCGAGCACCGCTCGCAAGTGGTCAATGTGGTTATCCACGTCTGACTTTCCGTGCTCGGCACGACTATGGACGAATATA
TCGTCAAAGTACGTTTGAGCGTACGCCCGGTGGGGCCTAAAACAACTGCGTCACAAGACGATTGGACGTTGCTGGTGCGTTCGACAGCCCCTGGGCATCA
CCAGCCACTCCCAGAGCATACCGCTCGGAGTACTCACCGCTGTCAGCGAATGTCGCTCGCTCTCATGAGCATTGGTAGTAGCCATCGACCAAGTCGAGCG
CGCTGTACAACGTACAGCCTACCATGTTGTTCTGCAGAACATCCTTGCGAGGAATCGGCGTTTGCGCCGGGATAGTGGCCGCATTCAGCTTGTTAAAAGC
ATGAACAATGCGCCACTTGCCGTTCGGCTTTCTGACACAGAACGTGGGTGTCGAGGGCGGAGACTTACTCTCACGCACCATCCCTGCCTCGTGCTTCGCA
CGGAAGAATGCGTCAATGACGTCACACTGCTCTCTCGGCAAAGGCCATTGCCTTGTTACGTCGTATTTGGTTCCAGGAACCAGGTCAATCGCATGACACA
CGCCTCGATCCGGAGGCAGGCCCGTCGGTGGGTCTTTTGAGACAGCGTCTCCATACTCCTTCGCCACCGGGTAGAAGGGATCCGAAGGATCTTTGAGGAT
CGCCGATCCACTTCTTGCGCTTAGCGCCTTCTTGGTGTCCTCTAGGACCGCGTCGTCCACGACGGATGAGGAGTTCAACTCCTCCTCAGGTCCCAGCAAG
ACCACCTCGGCTAGCTCGCCTGCCTTTAAGGCTTCGCCGAGCTCGTCAATGGACATCTCGTCCAGCTCTAGCAGAGCATCTGCAGCGGGCAGAGTATCAA
GGCTGATATCGCCTTCTACCTCCCCCGTCACTCCGTTCAAGAGTGTATACAGCTGTTCACAGCAATCACGTGGAGCATCACCGCTCGTCACGTTGGACAC
ATCGTCCGACGTCGAAGACGTCACAGACGCCCTGCGTCTTCTTCTCCTCTCCCTCCGCGACCGAGCCCGGCCCGGATGAGGGCGGTGTGGCGACATCTCC
GTCACCACCACCGGGTGCAGCAGCACCACCACTCCTCGAAGAGGATACAGTGTCTTGCAAGACACTCGGCTGAAAGCCAAGAGGTTCTTGACCTTCACAC
AGTGAACTAGGTGTCACTTCACCTGCATCTCCTGGGCCACGCCCATGATGCCTCGACTCGCAGTCGACCGCGACCCTCGGGTCACGCAGCGGTAGGTCAT
CGACCAGATTCATACCACTCAGTGGATTACGCGCCACTCCGCGCTCGTCCTCACTAGGACCCAGCAGTTGGTCATTGACCTGATCTGCACCGCTCCGCGG
ATAACGTGCCGCACCACGTACGCCCTCAGGGCAAACAGCAACCTCGTTGCTAACAATTTCGGACATACCAATGTCCAGCACTACGGCCGCCTCGGCCTCG
TGCTCGCGCCAAAAGCGCTTCTGCTTCCTAGCAGAGGTGGGTTCATGACTCACCAAAGCTCCACTAGGAGCAGGGTGCGACGCACCCAGCGTTTTCGACT
TCCAGTCGATCCATGGCTCATGACGTTCCAGCCATGCCATGCCAAGGATGAGGTCATACCTCGCATCCAGGTCTAAGCCCAAACAGCGTTCCACGCTATC
GAAGTTCTCAAACTTCACTCCAAGGTCGACAGAGACCTTCCACACAGTTACCAGTGTCCCCGTCGCGAGACGGACAGAGATCGTATCTCTCGTTGGCACT
TCCAGTGCCTCAGCATACAGCTGACTCCCTTCCAGCGTGGAGCGACGGGCGTAGTTGCCCGAGGCTCCCGAGTCAATCAAGACTCTCCATGGCTTTGCAA
AGCCCTTCACGTTCGCTTGAACGACCAGCAAGCCCGGCTTGCACACACTCTTCTCGTAAGAGAGCTCAGCTCTCTTCGGGGCTGAGCCCCGTTGTCCTCT
ACCTCTTCGAGGCACAACAGAACTCAGTTCTTCCCCAGTAGGCCGCCCCGCGCCTACTGGGAGTTGCCGTTTCCCGGCGATGACCCGGAGGGTTGGCTCG
CCGGAGCCTCGCGCTTCTTGCGCAGAGGGCAATAGGCCCTCAAGTGCTTAGTGCTATTGCACACAAAGCATCGGCGGATGCCGGCGCGCTGCTCCGCAGC
AAGAATCTCCGCTTCTTCATCTTCAGCATAGCTGAGGTCCATCGGCTCTGGACCGCTCGAAGAGCTTGCGCTACCAGCGCTCCAACCAGGTCGCGCCGAC
CTGAAGTTGTGCTCGGCATTCAATGCCACATCCACCGCCACTTCAAAAGAGTTAGGGTGTACCCGGAACACTTCCGTTCGAGCTGCGCTCACACGAAGTC
CCTTCATGAACACGGTCACGCTGACCAGTTCCGGAAGAGGGTCCGCCGCCATTCCGGCGATAAGAGTTCTCAACTCTTGGACATAGTCCAATAAATCCTT
CTTACCCTGGCGGGTAGCAAGGAACTTTGACCGGATACGGTACGCCTGATTAGGCGGCGCGAACACGCGCGAAAGCTGTTGCTTCAGCTGATCCCAAGTG
GGAAATGCAGCGTCAACAGACGTGCCGCACGTTAGTGCCCATTCGCGAGCGCGACCTCCAAGCCTGGAGATAGCCAGCGCCACGCGCTGATGCTCAGACT
GGAGCAGGGCCGATCCCATGGCCATCTCGACCTCACGGGTCCAGAGAAGGAGATTCTCTCCATCCTTCCCCTCGAAGGTTTTTACGCTCACCATGAGCGG
TTTCAGTCTCATAGACTCCTCACGCGTCATCGACGCCGCCGCCGTTGCGGCGCTCATCTTCTCTTGGACATGCTCCAAGAGCGCGTTCTCGTAGCGGGAG
AACGATTCCAGCCTGGCAGTGACCGCCTCTGGACCTTGCGATGCAAGATGAGCCACGCCCTCCGGGCCAAGCAAGGACATAAGCTTAGTAAGCGCGTCCT
GCTGCGCCGGGGGCAAATTCGCGAACACGGGGTGTTCCATCCTCGCATAGGATATAGTTAACCGACTCAGGAGCGGGATTGACTACAAGTGCTACCAAGT
GCAGCGGGGCTGCCGTAGCTTTAGCGTCAGAGGAAGACGTTCGACTCAAAGAGTCACTAATACTAAGTTCCTTATCCAAAGGACACTTACAGCCCAAGAC
CAGGGCTCAAAGTTAACACCTTAACTTTTATGCTTCAAAACCAGAAGTGTTTTATTTACTATTATTGCGGCCAAGCCGCCTAGGGGTAAATGTATCTGTT
TAACTATCTAGCACAGTTACACCTAATCAAATGCATAACGTGTGGCTTTCGGCCAACGTACTGAGAGACCTTGTTAACTCTCCAACTTATGTACTGAGAG
TTTGTTAACTCTCCGGGTACTTCGTACCCCTGTGTGTTCCACACCATGTAACCCCGTTACAGACTCTGTCG