Description :
From Genome Similarity Track
Location :
Scaffold_286:6- 4341
Transcript NameFunction/comments
Phypa_INRA-310PPTG_19991hypothetical protein

Sequence
4335 bases(100 bases per row)
TCGCACTATGCGTCAGCGACCTCGATGGCCGACTCAGACACCTCGGAAGGAGTCGAGCGAATGCAGCTTGGCCCCTCAGGAGCCACGATGCTGCAAACCA
GATCGCAACGTGTGCCGAACGTGACGCCCAGGACAGACGCTCCTGCGGCAGCCAGCACATCGAACGATAATCAAGACAGACTACAAACGTTCTTCAACTC
GGCGATGGAACGTTTCTTGATATAGCAACGCGCCGCACAGGGTCGCCAGCAGTGGCCCCGGCGAGAAGGACAGAGCCACAGGACGTCGATATGGAGTCAG
TAGGATCTGACCACGGAAAATACGACCCGGACGATCTGGACCTCCCCGTTTCCCGTCAAGCGACCGTAGCCACCGCTGCTACAGCGACTGGGCTGCCAGC
AATCACCCCTCGCATTCGCGTGTCGGCCATGTCGGAACCCAAGGAGTTCTCGGGGAAGGACGACGACGAAGATCGCGCGCGGGCTTGGATCGGCAAAGTA
AAGTCAGCCTTCGTCCGTGATCAGGCTCCAGACGACGAGAAGTGCCTGGTGCTTGGTGGCCTGTTCACTGGTCCGGCGTGTAACTGGTACCGGCAACTTA
GCCGGACCACGAGAGGCGACTGGAAAGAGCTTCTGCGCGAATTCGAAGTGCAGTTCTGTGGACTCGGAGTATCTGTCGCGAGACAATACTACCATGCGAG
GAAGCGCGCTGACGAGACGCCGCTGGAATACCTGCACCGCCTGAACGTCGCAGGACTGAGGGTAAAGCTGCGCGTGAAGAGCGGCGTATCCGACGTTCGC
CGCGAACACGTAAAACACTTCATCGAGACCCTGGACGACCGCGATCTAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNCTCGCGATCTATGCCTCGATCTTGTACGAGCTGCGAGAGATCGACTTCCACGAGATGAGCCGGAACCCTGGCCAAAAGACTGG
GGACGAAGCCCAAGCCGACGAAGTGGTACAGATTGCGCAGACGGACGAAAGGAACAAGTGGGACCGAGCGCAGGCAGCATTTGAGATGCTGAAGAACAAG
TTCGCGACGGCGCCAGTGCTGCGGCACTTCGATCCAGATCGGGTACCGGTTGTCGTGGTATATGCGAGTGATTGGGCGATCTCCGCAGCCTTAGTACAGG
AGCACGATGGCACGTATATGCCAGTGACATTCACCAGTCGCACGCTGAAGCCCAACGAGCTCAACTATGGTATGGTCGAGAAAGAGATCCTGGCTCTTCT
CCGGATCCTGGACGTGTGCTACTCCACACTGGTCACGAGGCCGATCAAGGTTCTAACACGGCACTCCACTCCAGCGTGGCTGATGCGATCCACAGGACTC
CAAGGCAGACTAGGCAACTGGGCGGCGCTGCTATC