Description :
From Genome Similarity Track
Location :
Scaffold_1560:6- 4206
Sequence
4200 bases(100 bases per row)
GGTTATTGGGAGAACGCCAACATGGTCGATGGTTTGAGCCTACCAAGGGTGAAGTCACTGCAGATCCACCTAAGGTCTGTCTGGTCACTGGATCCTATGG
ATCTGAGGATGTTGGATCCATGGATCTGCTAACAGGAGAGTCCCGTGGGTACTGGAAGTACCATGCCCCGGGAAAGTGGTTCAGACAAGCCAAGGTAGGG
GGCAAGATCAACAATGAAAAAGCAATCCTACTCCTAGATAGTGGTGCCGAGGTGTCTATACTGGATACCGCCTTTGCTCGTAAGGTTGGGTGCTAAGTGG
ATGGGAGTCGGATCCAAGATTGTGTTGGGATTGGTGAAGGCGTGTACCGTACGAACGGGAGAACGCGGATCAAGATCACGCTGGCAGGTTGTTTGGTGTA
TTGGTTTGACATTTGGGTCGGGGATCTCGCTGGTCAAGACGCCATCCTTGGGATGGATTTCATGGTGCCGGCCGGAGTGAGGTTGGATCTGGCGGATGGG
ACACTTTGTTTCCCTGACGAGATGCGGATCCAGCTCAGCGGACGGCGGCCGTTGTATGGAGCGAAGATGAGGATCATAAGGGGCGGATAAGACCACCTGG
ATCGAGCCCGGGGAAACTTGGGAGCTGCCAGACCGGTTAAAGTGGGCGGAACATGAAAGACGGTGGGTCGCCCGGGGCGAGAAATGGGTACCTACCGTAA
TCCAAGGACCAGGTCGATCGCAATACCTCCAGGTCACGAACGTCAGCGACAGGAGATTGTTACTGGACCATTATGAGGAGATCGGACGATGGTTGGCGAA
GGACGGTATCCCTAGACGACCTGGATATGTGTCAGTGGGATCCCGCCGCTACAAAGAATGGCAGATTCTGCTGTTCGAGGCGACTACCGAGATCGAATCC
CTCGGAGAGGTGGAGCTCCCGGCGGAGCCAACTGGCCCCTTGGTGGATCGGCCTTCATATCCAACTCCGCGAAAGATCCTGCAGAGGGATCGACGGGTTG
AGATCCAAGTAATGGAGGTTGGATCCACGACGGAAGACGATCCCCAGAGTCGGCCCTTAGATAACGCAGGGTCGGTGGATGAAGGATTGCAGAGGGCTAA
AGCCGAGCAGCCGGATCCCGCTGATCCACAAGTGAATCCAAGCTTTCCATAGGATAAAGTGCCTGGATCCCTATCGAGAGTGGCAACACTAGTCAAACCA
GAACCGTCGGGCTTAAACTCGTTAGAGGACCGACTAGATCCAACTGGTGGCTTCCCTAATATCAGGGTACCTGATCCCCCGAAGACAGAAGGACTGCCAG
GCGAAAGAGGGTCGCGGTGTTTGGATCCAATGGTGGATCCTACGAAGACGGAAGATGAGCAAGTCTGTTACCATGAAGGCGGGGATCTACACGCCGAGGA
TCTGGGAGAAGGCATGGCGGTGATTCCGGAGGTACCACTGACCACAGAAGAAGTCAAGATTGATGATATCCAAGTGGATCCAGGGGCGAACGAACCCACT
GAAGTGGATCGTCTGCGTCAGAAGATCTGGGAAAGCCGACATCTGCTGATCGGTAAGGGTAATGCGTTACCGCCCGCCGCCCGCGGAGTCAAATGTGACA
TCGATGTCGGCGACGCGAAGCCGATCGCTCAAAGGGTGCGGAAGGTGGCACCTCAGTTCCGAGAAAAACTGTCGGATCTGATTAAGGGCCTGCTGCAAGC
CAGGATCATCAGCTTCTCAACGTCCCCGTGGGCATCCCCAGTGGTAATTCATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCATTGATTACCGGCT
GGTTAACGGTCTGACTCGATTGATGGTGTATCCGATGCCTCTAATCAACGAGCTGTTGGAAGATCTGGATAAAGTACTCTGGTACTGTTCTCTAGACATG
GCCAGTGGTTTCTGGGTGGTTACTATGACGGATCGAGCTCGCGCAATATCCGCATTCATCACACTGTTTGGCCTGTTCGAGTGGAACCGGATGCCGTTCG
GATTGAAAAACGCACCCCATATCTACCAACGCCTGATCGATAACGCCCTCGATGGATTCACCCGAATACCGGAGTCCGAAACAGGTGGGTCTGGGGAAGG
CCATACGGAAGTGGATCCATTCGAAGCGGGGGAGCCAGGGGATCCTGGGACCCCATCTGTGTTAGGACGCAGATCTTACATCGACGACATTCTGATCCCG
GCGGAATCGTGGGATCAGTTGTGCGAGAGAGTGACGTCCTTACTGGAGGCGTGTACTAAGTGGAATCTCTCTATTAGTGTGGTAAAGAGCTATTGGGGGA
TGCGCAAGGTGGAGTACTTAGGCCATCGAGTTTTCAAGGAGGGATTGGAGGCGAATCCTAAGGACCTGTCTTCATTAGCCGATTTGTCCTTCCCACAGTC
GTTACGGGCGATGCAATCTTTCTTGGGCAGTTTGAACTACTACAGTCGGTTCATCGAGGATTACGCCCTGTTTACCGCGGTATTGTACGAATTGAGAGAG
GTAGATTTTGCCGCGATGACCCCCCCAACTGTCCAGATGAAATCCAACAAGCTCTGGCCCAGGAGATGCCGGATCCACGAAGGGATCCAAGTGGTAGGAC
GCCAGAAGAGGACCTGAAACAGGAGCTGGATCCACCCCGGGACCAACAGAGAGAGGATCCAGGCTGGATAGAGACGACGGAATAGAACATGGAACAGGCA
GAATCTCGGTGGATCCGAGCTCAACACGCATTCGGGGAACTGAGGAATAGAATCGCGACCACGCCTATCCTCCGTCATTTCGATCCAGAACGTCAACCTA
CGGTGATAGTTTATGCCAGTGACTGGGCAGTCTCAGCAGCTCTGGTACAAGAACATGAAGGGATCTGTCATCCAGTCACCTTCGTCAGCCGGACACTGAA
GCCGAATGAACTGAATTACGGAGCGGTGGAGAAAGAGATACTCGCGCTCCTGCGCGTGTTGGATCTCAATTACAACCTGCTGGTGGGAAGATCCATCCGG
ATCCTGACCCGACACTCTACGCTAGCTTGGCTGTTCAAGTCGGCCGGGTTACAAGGACGTTTGGGACAGTGGGCAGCTTTACTCTCGCCTTGGACACTGG
AGATTGTGAAATGTTCGAAAGGGGAAGACGAGATCCTGGGAGTCTTGGCCGCGAGCATCACACCTCGAGCTAAGATGGATGAAGCGCTGACTAGGATCGC
TCCTAAGAAAGAGCCCAAACGCCGGATCCAGACCCTGATCCCGACGGTACAAGTGGATGAGGATCTGTACGTCCTGAGCTTCGATGGATCCGCTCGCGTA
CGACGCGGATGAGGAGCATACAGCCCAATACTGTGGAGACTGCCCGGATGAGAAGTTGTACGGGCCAGATCCACTTATGCGGAGGGCCTCACCGTCAATG
AAGCGGAGTATAACGGGCTCCTGCTGGGTTTGGATCTACTAAAGGGACAGGATCCAAAAAGGCTGGTGATTTGTGGGGATTCAAACTTGGTGATCAGACA
GGTGCGAGGTGAGATTGACTGTAAGGCCCCGGCCCTAACACTGTTACGGCAGAAAGTGATGGTCCACCTGCGTGGATGGTTGAATCACGAGTTGGTGCAT
GTCAAGCGAGATTGGAATGCCAGTGCAGACAGCTTGGCCAGTGCCGCTTTACGGAATCAATGTGGTGTCGAAGTGGAGAGAGAAGCCGGGCATCAGGATC
TCGTTACATTGAACCGACTAGACGAAGTGGTGGTAGTTGGATCCAGGAAAAGAACAGTCCAGGTGATGGCCGTCACTAGGTCCAGAGGAAGGATTGGATC
CAGCCCCCAGATCCTCGAGGAAACATTTGTGAAGGGAGTACGTATTGAGCGGATCCTCAAAGCACAAAACGAGGAAACGTGGATCTTGGGACTAAAGAAG
TATCTGATGGGGGATGTACGAGACCTGAGTCGGGAGGATACTAAATCCTACAGTATTATCGCTACGGATTACGCAGTGGATCTGAATGACTTGCTCTTCT
ATTGCCCCCCTACGAAGAGAGTCCACGAGGATCGGGATGGATTGATGAGATTGGTGATGCCAGAAACCTTGCAACAGGATGTCCTACACCACTACCACGC
TAGCTTGGAAGGCGGACATCAGGGCATTGGTCGGACCTACCAACGGATCCGGGAATGTTTCCATTGGAGAGGACTATTCAAGAGTGTACAACGATATGTC